WormMine: Gene WBGene00003172

• WormBase Gene ID: WBGene00003172
• Gene Name: mec-8
• Sequence Name: F46A9.6
• Brief Description: mec-8 encodes a protein with two RNA recognition motifs (RRM); mec-8 is required for proper development of body wall muscle and chemosensory and touch receptor neurons and as a result, for embryonic and larval development, sensory neuron fasciculation, and mechanosensation; MEC-8 functions as an mRNA processing factor whose activity is required for alternative splicing of genes such as unc-52/perlecan, with which it interacts genetically to produce synthetic lethality at the two-fold stage of embryonic elongation; mec-8 mutations also exhibit synthetic lethality with mutations in a number of other genes, including the sym genes and daf-18; mec-8; unc-52 synthetic lethality is suppressed by mutations in smu-1 and smu-2 which both encode homologs of mammalian spliceosome-associated proteins; mec-8 is broadly expressed in the embryo and expressed in hypodermal and neuronal tissues in larvae.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable mRNA binding activity. Involved in several processes, including hemidesmosome assembly; mechanosensory behavior; and nematode larval development. Located in nucleus. Expressed in several structures, including head muscle; hypodermis; and vulva. Is an ortholog of human RBPMS (RNA binding protein, mRNA processing factor) and RBPMS2 (RNA binding protein, mRNA processing factor 2).
• Biotype: SO:0001217
• Genetic Position: I :3.76436 ±0.0003
• Length (nt): 3218

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003172

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F46A9.6.1	F46A9.6.1	1511	I: 9441010-9444227
Transcript:F46A9.6.2	F46A9.6.2	1928	I: 9441015-9444227

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F46A9.6	F46A9.6	939	I: 9441972-9442279

14 RNAi Result

• WBRNAi00047475
• WBRNAi00010907
• WBRNAi00015051
• WBRNAi00030266
• WBRNAi00086344
• WBRNAi00086346
• WBRNAi00086345
• WBRNAi00086348
• WBRNAi00086349
• WBRNAi00116845
• WBRNAi00092391
• WBRNAi00064338
• WBRNAi00083103
• WBRNAi00086342

56 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• rh170
• WBVar01602989
• WBVar01432535
• ok2043
• gk519864
• gk505823
• gk413869
• gk747757
• gk452713
• gk550333
• gk641710
• gk562829
• gk579727
• gk365566
• gk916160
• gk895034
• u303
• WBVar01342401
• u74
• u314
• csb22
• WBVar01932345
• ttTi26951
• gk118778

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003172
• Start: 9441010
• End: 9444227
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

165 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Embryonic class (E): genes that significantly increase in abundance at some point during embryogenesis.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_E
	Transcripts that showed significantly increased expression in spr-1(ok2144) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:spr-1(ok2144)_upregulated
	Strictly embryonic class (SE): genes that are the subset of embryonic genes that are not also classified as maternal.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SE

12 Expression Patterns

• Primary Identifier: Expr1031505
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6084
• Remark: Strain: BC11068
• Reporter Gene: [mec-8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAACCTTTTCCTTTAGTTCCGC] 3' and primer B 5' [CCGTCGATCTTCCGTTTG] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: intestine; Nervous System; nerve ring; head neurons; tail neurons

• Primary Identifier: Expr14691
• Pattern: We detected expression of the mec-8 fosmid reporter in many of the same cells, both neuronal and non-neuronal, plus strong expression in the ALM neuron. We did not detect mec-8 expression in motor neurons of the ventral nerve cord.

• Primary Identifier: Expr2304
• Pattern: Anti-MEC-8 serum recognized a nuclear antigen in wild-type C. elegans embryos. The youngest embryos to exhibit immunostaining contained about 50 cells, all of which showed nuclear staining. All nuclei showed staining in embryos containing up to hundreds of nuclei. Two mec-8 mutants, mec-8(u391) and mec-8(u314), failed to show any trace of nuclear staining at any stage of development. During the late proliferative phase of embryogenesis, prior to the onset of morphogenesis, MEC-8 staining was confined largely to hypodermal nuclei. Prior to this shift, MEC-8 was found in most nuclei, including nuclei that were also marked with an hlh-1::lacZ reporter, which is expressed in early blastomeres that subsequently produce only body wall muscle cells; but MEC-8 was not detectable in body muscles after the onset of morphogenesis. In L1-L4 larvae, MEC-8 was detected by anti-MEC-8 serum in the nuclei of the large hypodermal syncytium, hyp7, that covers most of the worm. This staining was fainter than the staining of the embryonic hypodermal nuclei, became even fainter during later larval development and was undetectable in adults. The nuclei of head hypodermal cells not fused with hyp7 (hyp4 and hyp5 nuclei in particular) stained well with anti-MEC-8 in all larval stages and in adults. Anti-MEC-8 also stained the nuclei of many neurons in the head (probably including chemosensory neurons); a few neurons in the central body region [including the ALM and AVM touch neurons, and neurons in the post-deirid]; vulval nuclei in L4 and adult stage hermaphrodites; anterior- and posterior-most intestinal nuclei; and other unidentified nuclei in the head and tail. The anterior-most muscle nuclei in the heads of larvae had low but detectable levels of MEC-8, but none of the muscle cells in the main body appeared to stain with anti-MEC-8.
• Subcellular Localization: nuclear staining

• Primary Identifier: Expr1151311
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr16013
• Pattern: C. elegans MEC-8 is expressed in specific tissues such as the hypodermis, as well as specific subsets of neurons, notably the touch neurons and phasmid neurons.

• Primary Identifier: Expr2305
• Remark: See Expr2304 for antibody staining data.
• Pattern: GFP was detected in larval hyp7 nuclei at levels reduced from those seen in embryonic hypodermis and was not detected in larval body muscle cells. There were some differences between the antibody and GFP results: first, GFP was not reliably detected in the nuclei of ALM and AVM; and second, the nuclei of ventral hypodermal cells had detectable levels of GFP in young (L1-L2 stage) larvae but did not appear to stain with anti-MEC-8 antibodies. The pattern of GFP expression by transgenic embryos carrying mec-8::gfp was very similar to the pattern of MEC-8 expression seen by immunolocalization. GFP was seen in most nuclei at about the 50-cell stage. Just prior to morphogenesis, GFP became brighter in hypodermal nuclei and faded in the nuclei of other cells. During embryonic elongation, hypodermal nuclei exhibited bright GFP fluorescence while other nuclei fluoresced faintly or not at all. The nuclei of hypodermal cells and their precursor cells were marked by staining with anti-LIN-26. The only difference between the GFP expression and the anti-MEC-8 staining was that the faint expression seen in non-hypodermal nuclei carrying mec-8::gfp was not detected with anti-MEC-8 serum. This difference could have been caused by overexpression or perdurance of the MEC-8::GFP fusion protein or by poor antibody sensitivity to low levels of MEC-8.
• Subcellular Localization: nuclei

• Primary Identifier: Expr2013502
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1018928
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram1761
• Remark: Original chronogram file: chronogram.677.xml
• Reporter Gene: [F46A9.6:gfp] transcriptional fusion.

• Primary Identifier: Expr2031736
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr14690
• Pattern: The classical mec-8::GFP promoter fusion drives expression in a number of cells, but not in the ALM neuron (Spike et al., 2002).

16 GO Annotation

9 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003172
• Start: 9441010
• End: 9444227
• Strand: -1

16 Ontology Annotations

4 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significanlty decreased expression in mec-8 (e398) comparing to in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_downregulated
	Transcripts that showed significanlty increased expression in mec-8 (e398) comparing to in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_upregulated
	Transcripts that showed significanlty increased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_upregulated_TRN
	Transcripts that showed significanlty decreased expression in touch receptor neurons in mec-8 (e398) animals comparing to in touch receptor neurons in N2 animals at L4 larva stage.	N.A.	WBPaper00062197:mec-8_downregulated_TRN

1 Sequence

• Length: 3218

1 Sequence Ontology Term

• Name: gene

14 Strains

• WBStrain00022557
• WBStrain00022566
• WBStrain00034402
• WBStrain00034416
• WBStrain00034373
• WBStrain00034372
• WBStrain00034389
• WBStrain00035033
• WBStrain00035035
• WBStrain00035034
• WBStrain00035053
• WBStrain00036718
• WBStrain00001615
• WBStrain00004159

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_9444228..9447361
• Length (nt): 3134
• Chromosome Location: I: 9444228-9447361
• Organism: Caenorhabditis elegans