Genomics
1 Transcripts
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| Transcript:F20G4.3.1 | F20G4.3.1 |
6494
 |
I: 7926623-7934577 |
Other
1 CDSs
| WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
|---|---|---|---|
| CDS:F20G4.3 | F20G4.3 |
6012
|
I: 7927071-7927198 |
38 RNAi Result
89 Allele
| Public Name |
|---|
| gk962858 |
| gk962706 |
| gk963902 |
| gk963849 |
| gk964316 |
| otn10689 |
| gk962622 |
| WBVar01432210 |
| WBVar01694825 |
| ne3409 |
| gk115919 |
| gk115920 |
| gk115921 |
| gk115922 |
| gk115916 |
| gk115917 |
| ok499 |
| gk115918 |
| gk115927 |
| gk347210 |
| gk115928 |
| gk900327 |
| gk115929 |
| gk496945 |
| gk115930 |
| gk643567 |
| gk115923 |
| gk470698 |
| gk115924 |
| gk693435 |
1 Chromosome Location
|
Feature . Primary Identifier |
Start | End | Strand |
|---|---|---|---|
| WBGene00003777 | 7926623 | 7934577 | -1 |
4 Data Sets
| Name | URL |
|---|---|
| WormBaseAcedbConverter | |
| GO Annotation data set | |
| C. elegans genomic annotations (GFF3 Gene) | |
| Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_7926504..7926622 | 119 | I: 7926504-7926622 | Caenorhabditis elegans |
142 Expression Clusters
| Regulated By Treatment | Description | Algorithm | Primary Identifier |
|---|---|---|---|
| oocyte proteins identified by two or more unique peptides during proteomics study. | In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. | WBPaper00038289:oocyte_protein | |
| Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
| adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
| Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. | N.A. | WBPaper00064071:NHR-49_interacting | |
| Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
| Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:GABAergic-neuron_expressed | |
| Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
| Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
| Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:NMDA-neuron_expressed | |
| Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:seam_expressed | |
| Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20) | |
| Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals. | Fold change > 2, FDR < 0.05 | WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20) | |
| Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations. | Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50. | DESeq2 fold change > 2, p-value < 0.01. | WBPaper00061007:S.aquatilis_downregulated |
| Maternal class (M): genes that are called present in at least one of the three PC6 replicates. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_M | |
| Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
| Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic. | A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. | [cgc5767]:expression_class_SM | |
| Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage. | DEseq2, fold change > 2 | WBPaper00064505:tamoxifen_upregulated | |
| Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
| Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_oocyte_depleted | |
| Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. | DESeq2, FDR < 0.05, fold change > 2. | WBPaper00065975:P-body_vs_WholeAnimal_depleted | |
| Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. | Cufflinks | WBPaper00065120:body-muscle-transcriptome | |
| Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage. | DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05. | WBPaper00066110:tetraploid_vs_diploid_downregulated | |
| Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. | All three experiments have CPM >= 1. | WBPaper00067147:germline_expressed | |
| Bacteria: B.thuringiensis | Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. | Cuffdiff | WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi) |
| Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. | To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. | WBPaper00045521:Gender_Neutral | |
| Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin. | N.A. | WBPaper00055862:antimycin_damt-1(gk961032)_regulated | |
| Transcripts that showed significantly decreased expression in the neurons of bcat-1(RNAi) animals at 5-days post L4 adult hermaphrodite stage, comparing to animals injected with empty vector. | DESeq2. FDR < 0.05. | WBPaper00060459:bcat-1(RNAi)_downregulated | |
| Proteins identified in extracellular vesicle. | N.A. | WBPaper00062669:extracellular-vesicle_protein | |
| Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. | EdgeR, FDR < 0.05, fold change < 0.5. | WBPaper00055971:nhl-2(ok818)_25C_upregulated | |
| Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background. | DESeq2, FDR < 0.05 | WBPaper00060683:hlh-11(ko1)_downregulated |
22 Expression Patterns
| Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
|---|---|---|---|---|
| Picture: Fig 4, Fig S1. | Expr4897 | At the time of pronuclear meeting in wild type, an anteriorly enriched cortical network of relatively large actomyosin bundles is replaced by a more finely reticular F-actin network in which NMY-2 is focused in small, isolated aggregates. Both F-actin and NMY-2 localize most densely to a cap covering the anterior half of the zygote, and a separate, less dense cap of actomyosin also is observed over the posterior pole. The lowest density of NMY-2 aggregates is consistently found in an intermediate zone that encircles the position of the NCC at the beginning of centration. Interestingly, the highest NMY-2 density is always found at the boundary between this intermediate zone and the anterior cap; until a late stage of centration, this myosin-dense ring is several micrometers anterior to the advancing NCC. Although aggregates appeared to be highly mobile, the overall NMY-2 distribution pattern persisted past the end of centration. | ||
| Expr1031766 | Tiling arrays expression graphs | |||
| Strain: BC14855 | [nmy-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAGTTGTCTTGTTCTCCTCGACT] 3' and primer B 5' [CGCTGGAGCTGTTGTTGTAA] 3'. | Expr5811 | Adult Expression: intestine; Nervous System; tail neurons; Larval Expression: intestine; Reproductive System; distal tip cell; Nervous System; tail neurons; | |
| Picture: Figs. 4C to E. | Expr8126 | NMY-2::GFP (zuIs45) localized to the membranes of proximal PGCs in late L4 hermaphrodites where spermatogenesis is occurring and was present in a similar pattern in males. | ||
| Expr13287 | The transcriptional reporter (nmy-2p::gfp) showed strong expression in seam cells in the three-fold embryo as well as in L1 and L2 larvae. Seam-specic expression seemed to decrease from embryo to larvae, becoming obscured by strong expression in other tissues during adulthood, including head neurons, the vulva, the posterior intestine, and the rectal gland. | |||
| Expr10990 | Enrichment of NMY-2::GFP was observed specifically at the membrane surrounding the rachis bridge. NMY-2::GFP was also observed in puncta in the distal germline. Because of the small size of the germ cells, it was not possible to determine if NMY-2::GFP exclusively localized to the membrane or is also present in the cytosol. At the loop region where the germ cells enlarge and undergo oocyte commitment, NMY-2::GFP displayed clear germ cell membrane localization (data not shown). | |||
| Expr3282 | Localized to cortical surfaces in the gonad, but distribution was distinct from that of ANI-2 (See Expr3281). Expression was less specific for the rachis surface and also localized prominently to the lateral surfaces of the developing oocytes. | |||
| Expr11057 | During tail tip morphogenesis (mL4 = mid-L4), foci of NMY-2::GFP are observed at the apical surfaces of the migrating tail tip cells. An NMY- 2::GFP cap forms at the posterior surface of the migrating tail tip cells, and later (lL4 = late L4) along the ventral surface of the entire male tail. | |||
| Expr13292 | NMY-2 exhibited approximately 4-fold enrichment at contracting edges versus non-contracting edges and approximately 7-fold enrichment at the rosette center relative to the planar contacts between cells engaged in the rosette. | |||
| Expr9195 | Myosin II localizes evenly in QR.a cell at metaphase but distributes asymmetrically during anaphase. | |||
| Marker117 | Marker for cytokinetic signaling. | |||
| Expr13046 | Before or during early stages of ventral enclosure, NMY-2:GFP localizes to cell boundaries and as foci that are scattered around the embryo. Just prior to pocket closure, the foci form a ring-like pattern around the ventral pocket, which appears to enrich as the pocket closes. Some of the foci in the ventral epidermal cells overlap with adhesion junctions, visualized by staining fixed embryos with MH27 antibodies that detect the adherens junction marker AJM-1, while other foci localize along the junction-free edges of the cells. Myosin also localizes near the surface of cells in the ventral pocket. Myosin appears to assemble into an interconnected network that spans multiple epidermal cells. Interestingly, the foci in the epidermal cells align with ANI-1 (C. elegans anillin)-positive neuroblasts found beneath the epidermal cells, while other foci appeared to be in the neuroblasts. The localization of myosin as foci in both the epidermal cells and neuroblasts suggests that myosin may be associated with contractile events in both cell types during ventral enclosure. The myosin foci in both the epidermal and neuroblast cells are highly dynamic during ventral enclosure and display intercellular patterns - as a ring around the pocket, and as star-like networks in the neuroblasts. | |||
| Expr11785 | At initiation of migration, DTCs express NMY-2. | |||
| Expr2032582 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr14311 | GFP tagged Myosin and Anillin, expressed under endogenous promoters, are visible in the cortex and contractile ring in 1 to 4 cell stage embryos. | |||
| Expr1170031 | Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191 | |||
| Expr2014341 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
| Expr1018001 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
| Expr3433 | As the embryo completes meiosis II, the sperm MTOC becomes visible in the posterior half of the embryo and moves into close association with the cortex. The sperm MTOC either appears and remains at the posterior pole or appears at an abaxial position before shifting to the posterior pole; this variation presumably reflects variation in the site of sperm entry. Regardless of its initial position, there was an immediate cessation in the formation of new NMY-2::GFP foci in the cortical region nearest the sperm MTOC. Existing foci and smaller filaments in this region moved rapidly and radially away from the sperm MTOC, generating a posterior zone devoid of foci and with a relatively smooth surface membrane. At the same time, foci throughout the cortex began to move toward the opposite, anterior pole at speeds up to 7.66 +/- 1.0 um/min (n = 6). Local clusters or chains of foci and interfoci continued their apparent contractions while moving collectively to the anterior, generating waves of surface invaginations previously described as ruffling. The general, anterior movement of foci was altered in the vicinity of pronounced surface contractions, where local foci moved transiently toward the contraction. The anterior flow generated a focus-rich anterior cap and a complementary posterior clear zone containing only small, dispersed filaments. Within the anterior cap, individual foci continued to coalesce, move and disappear with lifetimes similar to those seen in earlier embryos. Within the posterior clear zone, small filaments moved toward the anterior, and appeared to coalesce into new foci near the posterior rim of the anterior cap. This posterior rim eventually constricted about the circumference of the egg to form the pseudocleavage furrow. Thus a local change in the assembly/disassembly dynamics of NMY-2::GFP foci near the sperm MTOC, plus a continuous flow of NMY-2::GFP-containing structures away from the sperm MTOC, results in an enrichment of NMY-2::GFP at the anterior cortex. Near the end of meiosis II, but prior to the onset of cortical flows, NMY-2::GFP was enriched throughout the cortex in a dynamic network of filaments and numerous dense foci. Individual foci appeared to coalesce from an initially dispersed population of smaller filaments. Once formed, foci moved short distances toward or away from one another before disappearing again, with average lifetimes of 117.9 39.8 s (n = 66 foci in 3 embryos). Neighboring foci were often linked by thicker filaments that were called interfoci. Variably shaped clusters or chains of foci and interfoci often appeared to contract simultaneously, and these contractions were associated with shallow, transient invaginations in the surface of the embryo. Previous immunostaining studies did not detect an enrichment of NMY-2 at the anterior cortex during the first cell cycle. These experiments were repeated using the fixation and staining conditions in this article and endogenous NMY-2 was indeed distributed in the same, asymmetrical pattern as described here for NMY-2::GFP in living embryos. | |||
| Expr3114 | NMY-2 and UNC-45 are concentrated at the cell cortex, and the staining patterns are largely coincident (although there are slight differences in intensity). Cortex staining for UNC-45 is apparent both where a fluorescent secondary antibody is used, and where UNC-45 antisera is directly labeled with a fluorescent marker (data not shown). Therefore, the two proteins colocalize in vivo, supporting the two-hybrid evidence that they may physically interact. | |||
| Original chronogram file: chronogram.501.xml | [F20G4.3:gfp] transcriptional fusion. | Chronogram1620 | ||
| Expr1149088 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 |
33 GO Annotation
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| part_of(GO:0055059) | involved_in |
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| located_in | |
| existence_overlaps(GO:0055059) | located_in |
14 Homologues
| Type |
|---|
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
| orthologue |
33 Ontology Annotations
| Annotation Extension | Qualifier |
|---|---|
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| enables | |
| involved_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| enables | |
| enables | |
| enables | |
| enables | |
| located_in | |
| located_in | |
| located_in | |
| located_in | |
| involved_in | |
| involved_in | |
| involved_in | |
| part_of(GO:0055059) | involved_in |
| part_of | |
| part_of | |
| located_in | |
| part_of | |
| located_in | |
| existence_overlaps(GO:0055059) | located_in |
1 Upstream Intergenic Region
| WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
|---|---|---|---|---|---|
| intergenic_region_chrI_7934578..7936263 | 1686 | I: 7934578-7936263 | Caenorhabditis elegans |
