WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00008435 Gene Name  glna-2
Sequence Name  ? DH11.1 Organism  Caenorhabditis elegans
Automated Description  Predicted to enable glutaminase activity. Predicted to be involved in glutamate biosynthetic process and glutamine catabolic process. Predicted to be located in mitochondrion. Expressed in head neurons. Human ortholog(s) of this gene implicated in developmental and epileptic encephalopathy 71 and lymphangioleiomyomatosis. Is an ortholog of human GLS (glutaminase). Biotype  SO:0001217
Genetic Position  II :0.632527 ±0.002174 Length (nt)  ? 3000
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00008435

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:DH11.1c.1 DH11.1c.1 1867   II: 8008634-8011400
Transcript:DH11.1a.1 DH11.1a.1 2060   II: 8008674-8011633
Transcript:DH11.1c.2 DH11.1c.2 1294   II: 8009498-8011400
Transcript:DH11.1c.3 DH11.1c.3 1120   II: 8009573-8011400
Transcript:DH11.1c.4 DH11.1c.4 1423   II: 8009752-8011600
Transcript:DH11.1b.1 DH11.1b.1 573   II: 8010632-8011400
 

Other

3 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:DH11.1a DH11.1a 1818   II: 8008683-8008743
CDS:DH11.1b DH11.1b 573   II: 8010632-8010727
CDS:DH11.1c DH11.1c 1041   II: 8010062-8010277

3 RNAi Result

WormBase ID
WBRNAi00043543
WBRNAi00012618
WBRNAi00030439

35 Allele

Public Name
gk963801
gk963053
gk962682
WBVar01695689
gk394856
gk418191
gk814633
gk924239
gk685074
gk514865
gk886567
gk536170
gk871368
gk559084
gk873483
gk364246
gk534036
gk631587
gk580549
gk486978
gk820476
gk567643
gk148042
gk148041
WBVar01666199
gk148044
WBVar00226574
gk148043
ttTi22213
cxTi3801

1 Chromosome

WormBase ID Organism Length (nt)
II Caenorhabditis elegans 15279421  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00008435 8008634 8011633 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_8011634..8012815   1182 II: 8011634-8012815 Caenorhabditis elegans

179 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Genes with expression altered >= 3-fold in dpy-10(e128) mutants. Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)). WBPaper00035873:dpy-10_regulated
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
  TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood. SAM WBPaper00031040:TGF-beta_adult_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:AVE-neuron_L1-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:bodywall-muscle_L1-larva_expressed
  Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals. Fold change > 2, FDR < 0.01. WBPaper00065993:glp-1(e2141)_upregulated
  Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day5_vs_Day1_downregulated
  Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2. DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1. WBPaper00046012:tdp-1(ok803)_upregulated
  Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites. DESeq2, fold change > 2, FDR < 0.05 WBPaper00065835:Day11_vs_Day1_downregulated
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage. edgeR, fold change > 2, FDR < 0.05 WBPaper00060909:atfs-1(cmh15)_downregulated
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals. Fold change > 2, FDR < 0.05 WBPaper00064088:Day-1-adult_vs_L4_upregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq. Cuffdiff, ajusted p-value < 0.01. WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
  Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation). CuffDiff2 WBPaper00051265:F4_hrde-1(tm1200)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:S.aureus-4h_upregulated_N2
  Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684) To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
  Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2. To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs. WBPaper00047131:daf-2(e1370)_upregulated_N2-background
  Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage. DESeq2 version 1.22.2, p < 0.05 WBPaper00064716:paraquat_downregulated
  Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals. NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%. WBPaper00064727:daf-2(e1370)_upregulated
  Transcripts that showed significantly decreased expression in N2 day 5 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day5_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day7_vs_Day1_downregulated_Illumina
  Transcripts that showed significantly decreased expression in N2 day 7 adults comparing to in N2 day 1 adult animals according to Oxford Nanopore Technologies Direct RNA sequencing (Nanopore DRS). DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day7_vs_Day1_downregulated_Nanopore
Heat Shock: 35C 4 hours at L4 larva stage. Transcripts that showed significantly decreased expression after L4 larva N2 animals were heat stressed at 35C for 4 hours DESeq2 WBPaper00057154:HeatShock_downregulated_mRNA
  Transcripts that showed significantly decreased expression in N2 day 10 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. DESeq fold change > 2, FDR < 0.05. WBPaper00067499:Day10_vs_Day1_downregulated_Illumina

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Strain: BC10131 [DH11.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATGGCGTCGGTAATTCAGAG] 3' and primer B 5' [TCGAACACGTCTGCAAATTC] 3'. Expr5635 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Larval Expression: intestine; body wall muscle; hypodermis;  
    Expr1033665 Tiling arrays expression graphs  
    Expr13155 Expression pattern of a glna-2 reporter that contains 3 kb sequences upstream of the first exon of the gene. Expression is observed in a very small number of neurons in the head.  
    Expr2012103 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2030339 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1147536 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
    Expr1018270 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.542.xml [DH11.1:gfp] transcriptional fusion. Chronogram1660    

9 GO Annotation

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables

8 Homologues

Type
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00008435 8008634 8011633 1

9 Ontology Annotations

Annotation Extension Qualifier
  located_in
  involved_in
  involved_in
  involved_in
  enables
  enables
  enables
  enables
  enables

2 Regulates Expr Cluster

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in glna-3(syb1403); glna-2(syb1406)glna-1(syb1405) triple knockout mutant comparing to in N2 animals at L1 larva stage. DESeq2, fold change > 2. WBPaper00065074:glna(-)_upregulated
  Transcripts that showed significantly decreased expression in glna-3(syb1403); glna-2(syb1406)glna-1(syb1405) triple knockout mutant comparing to in N2 animals at L1 larva stage. DESeq2, fold change > 2. WBPaper00065074:glna(-)_downregulated

1 Sequence

Length
3000

1 Sequence Ontology Term

Identifier Name Description
gene  

1 Strains

WormBase ID
WBStrain00001185

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrII_8004258..8008633   4376 II: 8004258-8008633 Caenorhabditis elegans