WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00010908 Gene Name  imph-1
Sequence Name  ? M88.5 Brief Description  The protein product of this gene is predicted to contain a glutamine/asparagine (Q/N)-rich ('prion') domain, by the algorithm of Michelitsch and Weissman (as of the WS77 release of WormBase, i.e., in wormpep77).
Organism  Caenorhabditis elegans Automated Description  Predicted to enable mRNA 3'-UTR binding activity. Predicted to be involved in nervous system development and regulation of gene expression. Predicted to be located in cytosol and nucleus. Expressed in tail. Human ortholog(s) of this gene implicated in type 2 diabetes mellitus. Is an ortholog of human IGF2BP1 (insulin like growth factor 2 mRNA binding protein 1); IGF2BP2 (insulin like growth factor 2 mRNA binding protein 2); and IGF2BP3 (insulin like growth factor 2 mRNA binding protein 3).
Biotype  SO:0001217 Genetic Position  III :-3.11119±
Length (nt)  ? 6823
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00010908

Genomics

6 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:M88.5c.1 M88.5c.1 3351   III: 4553616-4560433
Transcript:M88.5e.1 M88.5e.1 3301   III: 4553617-4560431
Transcript:M88.5a.1 M88.5a.1 3276   III: 4553618-4560438
Transcript:M88.5e.2 M88.5e.2 3276   III: 4553630-4560431
Transcript:M88.5b.1 M88.5b.1 2243   III: 4555653-4559744
Transcript:M88.5d.1 M88.5d.1 3005   III: 4555654-4560429
 

Other

5 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:M88.5a M88.5a 2487   III: 4553713-4553826
CDS:M88.5b M88.5b 2115   III: 4555781-4555807
CDS:M88.5e M88.5e 1944   III: 4556251-4556511
CDS:M88.5c M88.5c 2565   III: 4553713-4553826
CDS:M88.5d M88.5d 2193   III: 4555781-4555807

9 RNAi Result

WormBase ID
WBRNAi00051074
WBRNAi00051075
WBRNAi00017283
WBRNAi00005966
WBRNAi00034501
WBRNAi00002132
WBRNAi00070779
WBRNAi00084848
WBRNAi00070778

83 Allele

Public Name
WBVar01692362
WBVar01692363
WBVar01263113
WBVar01263114
WBVar01263115
WBVar01263116
WBVar01263112
WBVar01263118
WBVar01263119
WBVar01263120
WBVar01541719
h14167
WBVar01938960
tm1623
WBVar01445348
gk954300
WBVar02034153
gk668237
gk504782
gk589335
gk768553
gk589857
gk883813
gk723460
gk915110
gk441569
gk604913
gk529154
gk579414
gk685110

1 Chromosome

WormBase ID Organism Length (nt)
III Caenorhabditis elegans 13783801  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00010908 4553616 4560438 1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4560439..4562737   2299 III: 4560439-4562737 Caenorhabditis elegans

134 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
  Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Proteins interacting with NHR-49-GFP according to co-IP and LC-MS. N.A. WBPaper00064071:NHR-49_interacting
  Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:arcade_intestinal-valve_expressed
  Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:body-muscle_expressed
  Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:GABAergic-neuron_expressed
  Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:hypodermis_expressed
  Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:intestine_expressed
  Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:NMDA-neuron_expressed
  Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:pharynx_expressed
  Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging. Cufflinks FPKM value >=1. WBPaper00050990:seam_expressed
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Transcripts detected in germline isolated from day-1 adult hermaphrodite animals. All three experiments have CPM >= 1. WBPaper00067147:germline_expressed
  Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells. Log2 Fold change > 2 or <-1, p-value < 0.05. WBPaper00053599:oocyte_vs_mitosis_upregulated
  Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy. Cufflinks WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours. Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours. Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control. WBPaper00061341:28C_24h_downregulated
  Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours. The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data. WBPaper00065373:Cisplatin_downregulated_WT
  Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066594:ilc-17.1(syb5296)_upregulated
  Proteins interacting with HA-PPM-1.D. N.A. WBPaper00062498:PPM-1.D_interacting
  Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis. To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq. WBPaper00045521:Gender_Neutral
  Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C. EdgeR, FDR < 0.05, fold change < 0.5. WBPaper00055971:nhl-2(ok818)_25C_upregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours. Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50. Cuffcompare and Cuffdiff WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
  Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2 at early embryo stage. DESeq2, FDR < 0.05 WBPaper00058691:sin-3(tm1276)_upregulated
  Transcripts that showed significantly decreased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2. DEseq 1.18.0, adjusted p-value < 0.05. WBPaper00056471:aak-1(tm1944);aak-2(ok524)_downregulated
24 hours of AgNPs exposure. Genes downregulated more than 2 fold after 24 hours of AgNPs exposure. Statistical differences between the control and exposed worms were determined by a parametric t test, and a Pearson correlation test was performed for correlation analysis, using the Statistical Package for the Social Sciences (SPSS, Chicago, IL). WBPaper00034661:AgNPs_downregulated
  Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage. DESeq WBPaper00053302:alovudine_24h_regulated

10 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Mosaic population. Strain: BC13172 [M88.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTATTTTTGGAAGCACGCAGTAT] 3' and primer B 5' [TTTTGTTGTAGTGCACTGTGTCC] 3'. Expr6438 Adult Expression: pharynx; intestine; Reproductive System; distal tip cell; spermatheca; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; Nervous System; nerve ring; head neurons; unidentified cells in tail ;  
Also expressed in (comments from author) : Mosaic population. Strain: BC12729 [M88.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTATTTTTGGAAGCACGCAGTAT] 3' and primer B 5' [TTTTGTTGTAGTGCACTGTGTCC] 3'. Expr6439 Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; Nervous System; head neurons; neurons along body; tail neurons;  
    Expr2018123 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.243.xml [M88.5:gfp] transcriptional fusion. Chronogram1309    
    Expr1028764 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
Original chronogram file: chronogram.616.xml [M88.5:gfp] transcriptional fusion. Chronogram1696    
    Expr1154776 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  
Original chronogram file: chronogram.604.xml [M88.5:gfp] transcriptional fusion. Chronogram1683    
    Expr1034788 Tiling arrays expression graphs  
    Expr2036260 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  

10 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables

15 Homologues

Type
orthologue
orthologue
orthologue
orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
orthologue
orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00010908 4553616 4560438 1

10 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  located_in
  located_in
  located_in
  involved_in
  involved_in
  enables
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
6823

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00055390
WBStrain00002282

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrIII_4552276..4553615   1340 III: 4552276-4553615 Caenorhabditis elegans