WormMine: Gene WBGene00011232

• WormBase Gene ID: WBGene00011232
• Gene Name: pck-2
• Sequence Name: R11A5.4
• Brief Description: pck-2 is one of three C. elegans genes that encode proteins with similarity to phosphoenolpyruvate carboxykinase (PEPCK); by similarity, the products of pck-2 are predicted to function in gluconeogenesis.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable manganese ion binding activity and phosphoenolpyruvate carboxykinase (GTP) activity. Predicted to be involved in several processes, including carboxylic acid metabolic process; cellular response to glucose stimulus; and gluconeogenesis. Predicted to be located in cytosol and mitochondrion. Expressed in several structures, including body wall musculature; hypodermis; muscle cell; pharynx; and in male. Human ortholog(s) of this gene implicated in Alzheimer's disease and type 2 diabetes mellitus. Is an ortholog of human PCK1 (phosphoenolpyruvate carboxykinase 1).
• Biotype: SO:0001217
• Genetic Position: I :2.38327±
• Length (nt): 5965

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00011232

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R11A5.4a.1	R11A5.4a.1	2447	I: 7866136-7872100
Transcript:R11A5.4a.2	R11A5.4a.2	2275	I: 7866249-7872080
Transcript:R11A5.4d.1	R11A5.4d.1	1857	I: 7866556-7871883
Transcript:R11A5.4b.1	R11A5.4b.1	2889	I: 7869096-7872077
Transcript:R11A5.4c.1	R11A5.4c.1	1764	I: 7870027-7871883

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R11A5.4a	R11A5.4a	1965	I: 7866401-7866436
CDS:R11A5.4b	R11A5.4b	1890	I: 7869901-7871132
CDS:R11A5.4c	R11A5.4c	1764	I: 7870027-7871132
CDS:R11A5.4d	R11A5.4d	1857	I: 7866556-7866588

8 RNAi Result

• WBRNAi00001222
• WBRNAi00051759
• WBRNAi00051760
• WBRNAi00077181
• WBRNAi00004079
• WBRNAi00034849
• WBRNAi00116976
• WBRNAi00090555

66 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• otn10685
• gk962622
• WBVar01432193
• gk962720
• WBVar02122894
• gk953921
• WBVar02072890
• WBVar02072889
• WBVar02072222
• ttTi17361
• ttTi21918
• WBVar00537723
• gk658297
• gk115793
• gk115794
• WBVar01902414
• gk940008
• gk940009
• h16851
• WBVar01574012
• gk115792
• ok2586
• gk115799
• gk115800
• gk115801

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00011232
• Start: 7866136
• End: 7872100
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

266 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly decreased expression in AGP22 [nhr-49(nr2041)I;glp-1(e2141)III] comparing to in CF1903 [glp-1(e2144)III] at Day 2 adults.	Fold change > 2, p Value of < 0.05 and a false discovery rate (FDR) of < 0.05.	WBPaper00061530:nhr-49(e2144)_downregulated
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Genes that showed significantly increased expression in wrn-1(gk99) comparing to in N2, according to RNAseq.	DESeq was used to calculate the fold changes, log fold changes, and significance of the changes for each comparison.	WBPaper00045934:wrn-1(gk99)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts that showed significantly decreased expression in atfs-1(cmh15) (null allele) animals comparing to in N2 animals at L4 larva stage.	edgeR, fold change > 2, FDR < 0.05	WBPaper00060909:atfs-1(cmh15)_downregulated
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_daf-16(mu86);glp-1(e2141)
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in enriched nuclei of daf-2(e1370) comparing to in wild type nuclei.	edgeR, fold change > 2, FDR < 0.05	WBPaper00067267:daf-2(e1370)_upregulated_nuclei
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression at the intestine cells of daf-2(e1370) comparing to the intestine cells of N2 animals at L2 larva stage.	DESeq2 (version 1.24.0), fold change >= 2, FDR < 0.05	WBPaper00064632:daf-2(e1370)_upregulated_intestine

16 Expression Patterns

• Primary Identifier: Expr4233
• Pattern: The reporter gene that contains R11A5.4 promoter is expressed in C muscle cells.

• Primary Identifier: Expr6502
• Remark: Also expressed in (comments from author) : Mosaic population Strain: BC10543
• Reporter Gene: [R11A5.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GACTGGAGTCATTGGGTACGA] 3' and primer B 5' [CCGACTGTGCCGAAACTT] 3'.
• Pattern: Adult Expression: intestine; Reproductive System; vulval muscle; spermatheca; Larval Expression: intestine

• Primary Identifier: Expr12929
• Pattern: Transcripts encoding enzymes required for gluconeogenesis, mdh-1, mdh-2, and pck-2 were expressed at relatively high levels in dauer larvae.

• Primary Identifier: Expr2033013
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1034931
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15027
• Pattern: PCK-2::YFP accumulated in the intestine, epidermis, body wall muscle, pharyngeal muscles, and sex muscles of both sexes; no neural expression was detectable. Expression of PCK-2 in the intestine and pharyngeal muscle is consistent with the earlier report that these tissues contain PEPCK activity (Yuan et al., 2016); however, in these tissues, the expression pattern suggests that the enzyme is likely expressed from pck-2, instead of the pck-1.

• Primary Identifier: Expr15028
• Subcellular Localization: Subcellular analysis with a mitochondrial marker showed that PCK-2 has no association with mitochondria, but resides in the cytoplasm.

• Primary Identifier: Expr1155424
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2014779
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15201
• Pattern: In younger animals under standard growth conditions, the Is[Ppck-2 pck-2::gfp] translational fusion is expressed in the pharynx, in the intestine, in bodywall muscle, and in hypodermis. In adults, Is[Ppck-2 pck-2::gfp] expression becomes strikingly restricted to the very most anterior and posterior intestinal cells.

• Primary Identifier: Expr1028959
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr15202
• Subcellular Localization: We also note that, consistent with its assignment as a PEPCK-C ortholog, PCK-2::GFP appears localized to the cytoplasm in the cells in which it is expressed.

• Primary Identifier: Expr15203
• Pattern: We noted a striking difference in GFP expression between the functional PCK-2::GFP translational fusion and the Ppck-2 transcriptional reporter: while the PCK-2::GFP translational fusion is constitutively expressed, the pck-2 promoter-only transcriptional reporter is expressed solely in the intestine and only under food limitation conditions.

• Primary Identifier: Expr4049
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Broadly expressed in soma/embryo.

• Primary Identifier: Chronogram1624
• Remark: Original chronogram file: chronogram.505.xml
• Reporter Gene: [R11A5.4:gfp] transcriptional fusion.

• Primary Identifier: Chronogram761
• Remark: Original chronogram file: chronogram.18.xml
• Reporter Gene: [R11A5.4:gfp] transcriptional fusion.

21 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00011232
• Start: 7866136
• End: 7872100
• Strand: 1

21 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5965

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00032650
• WBStrain00049322
• WBStrain00002263

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_7863570..7866135
• Length (nt): 2566
• Chromosome Location: I: 7863570-7866135
• Organism: Caenorhabditis elegans