Genomics
6 Transcripts
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
Transcript:H06H21.10e.1 | H06H21.10e.1 |
4155
![]() |
IV: 4827853-4846893 |
Transcript:H06H21.10a.1 | H06H21.10a.1 |
4168
![]() |
IV: 4827853-4841127 |
Transcript:H06H21.10f.1 | H06H21.10f.1 |
4273
![]() |
IV: 4827853-4846893 |
Transcript:H06H21.10b.1 | H06H21.10b.1 |
4050
![]() |
IV: 4827853-4841127 |
Transcript:H06H21.10c.1 | H06H21.10c.1 |
3795
![]() |
IV: 4828747-4841127 |
Transcript:H06H21.10d.1 | H06H21.10d.1 |
3900
![]() |
IV: 4828747-4846893 |
Other
6 CDSs
WormMine ID | Sequence Name | Length (nt) | Chromosome Location |
---|---|---|---|
CDS:H06H21.10f | H06H21.10f |
4050
![]() |
IV: 4828076-4828111 |
CDS:H06H21.10c | H06H21.10c |
3795
![]() |
IV: 4828747-4828848 |
CDS:H06H21.10d | H06H21.10d |
3900
![]() |
IV: 4828747-4828848 |
CDS:H06H21.10a | H06H21.10a |
3945
![]() |
IV: 4828076-4828111 |
CDS:H06H21.10b | H06H21.10b |
3813
![]() |
IV: 4828090-4828111 |
CDS:H06H21.10e | H06H21.10e |
3918
![]() |
IV: 4828090-4828111 |
262 Allele
Public Name |
---|
gk964500 |
gk963722 |
gk963150 |
cxTi9097 |
gk711735 |
WBVar01569001 |
tm1773 |
WBVar02020557 |
gk376655 |
WBVar00188824 |
WBVar00188825 |
WBVar00188826 |
WBVar00188827 |
WBVar00188828 |
WBVar00188829 |
WBVar00188820 |
WBVar00188821 |
WBVar00188822 |
WBVar00188823 |
WBVar00188830 |
WBVar00188817 |
WBVar00188818 |
WBVar00188819 |
WBVar01825776 |
h10621 |
h8954 |
h17623 |
WBVar02073346 |
tm2332 |
tm1634 |
1 Chromosome Location
Feature . Primary Identifier |
Start | End | Strand |
---|---|---|---|
WBGene00019166 | 4827853 | 4846893 | -1 |
4 Data Sets
Name | URL |
---|---|
WormBaseAcedbConverter | |
GO Annotation data set | |
C. elegans genomic annotations (GFF3 Gene) | |
Panther orthologue and paralogue predictions |
1 Downstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIV_4827320..4827852 | 533 | IV: 4827320-4827852 | Caenorhabditis elegans |
252 Expression Clusters
Regulated By Treatment | Description | Algorithm | Primary Identifier |
---|---|---|---|
Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. | DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. | WBPaper00060811:L1_vs_adult_upregulated_neural | |
Transcripts of coding genes that showed significantly decreased expression in muscle. | DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. | WBPaper00062325:muscle_depleted_coding-RNA | |
Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. | DESeq. False discovry rate (FDR) < 0.1. | WBPaper00048988:neuron_expressed | |
adult vs dauer larva | Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. | N.A. | WBPaper00050488:adult_vs_dauer_regulated_N2_20C |
Osmotic stress | Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present | DESeq(version 1.10.1), FDR < 0.05. | WBPaper00050726:OsmoticStress_regulated_Food |
Bacteria infection: Enterococcus faecalis | Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. | For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. | WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray |
Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin_upregulated | |
Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:body-muscle_expressed | |
Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:hypodermis_expressed | |
Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging. | Cufflinks FPKM value >=1. | WBPaper00050990:intestine_expressed | |
Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage. | DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01. | WBPaper00056169:rrf-3(pk1426)_upregulated_embryo | |
Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO. | Fold change > 2. | WBPaper00064306:Agaro-oligosaccharides_upregulated | |
Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2. | DESeq2, fold change > 2, p-value < 0.01. | WBPaper00061203:sin-3(tm1276)_upregulated | |
Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage. | DESeq2(v1.32.0), FDR < 0.05. | WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs | |
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure. | Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2). | DEseq 1.18.0, adjusted p-value < 0.05. | WBPaper00056471:S.aureus-4h_upregulated_N2 |
Transcripts that showed significantly decreased expression in N2 day 4 adults comparing to in N2 day 1 adult animals according to Illumina RNASeq. | DESeq fold change > 2, FDR < 0.05. | WBPaper00067499:Day4_vs_Day1_downregulated_Illumina | |
Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage. | DESeq | WBPaper00053302:stavudine_24h_regulated | |
Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult. | DESeq2, fold change > 2, adjusted p-value < 0.01 | WBPaper00058598:sin-3(tm1276)_downregulated | |
Transcripts that showed significantly decreased expression in dissected female germline comparing to in dissected male germline. | Log2 Fold change > 2 or <-1, p-value < 0.05. | WBPaper00053599:female_vs_male_downregulated | |
Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. | The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. | WBPaper00044736:oscillating_dev_expression | |
Growth temperature | Transcripts that are significantly downregulated at 15C compared to both 25C and 20C, with no statistical difference between 25C and 20C, in worms feeding B. subtilis PY79. | DESeq2 and EdgeR, adjusted p-value < 0.05. | WBPaper00053814:15C_downregulated_PY79 |
Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:hda-1(ne4752)_upregulated | |
Transcripts that showed significantly increased expression in ubc-9(ne4833[ubc-9(G56R)] in gonads dissected from 1-day old adult animals. | Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. | WBPaper00061479:ubc-9(ne4833)_upregulated | |
Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain. | RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis. | WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR | |
Transcripts that showed significantly increased expression in wdr-23(mac32) embryos from parents fed with E. coliHB101, comparing to N2 embryos parents fed with E. coli HB101. | DESeq2, Fold Change > 2 or < 0.5. | WBPaper00059566:wdr-23(mac32)_upregulated | |
Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals. | DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2. | WBPaper00062159:hda-2(ok1479)_upregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Allantoin_downregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rapamycin-Metformin_downregulated | |
Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. | DESeq2(v1.14.1), fold change > 2, p-value < 0.05 | WBPaper00055354:Rifampicin-Allantoin_downregulated | |
Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2. | Student's t-test, fold change > 2, p-value < 0.05. | WBPaper00055386:daf-2(e1370)_upregulated |
11 Expression Patterns
Remark | Reporter Gene | Primary Identifier | Pattern | Subcellular Localization |
---|---|---|---|---|
Expr2035435 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). | |||
Strain: BC13378 | [H06H21.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTCTGAACCTTGTTCAATTGTGT] 3' and primer B 5' [ACTGAAGATCCCTCCGCC] 3'. | Expr6271 | Adult Expression: intestine - posterior cells; Larval Expression: intestine - posterior cells; | |
Expr12797 | tat-2 reporter is first clearly detectable in 2-fold stage embryos in two sets of pharyngeal cells, the developing pharyngeal-intestinal valve and a set of cells in the posterior. By the first larval (L1) stage, GFP fluorescence also appears in the intestine. L4 and adult animals exhibit reporter signals in unidentified cells of the pharyngeal procorpus, the gland cells located in the posterior bulb of the pharynx, the pharyngeal-intestinal valve, rectal gland cells, the intestine and all cells of the excretory system. tat-2 reporter signals are also seen in L4 larvae in the primary vulval lineage vulE and vulF cells and in the proximal gonad. The vulval fluorescence vanishes and a moderately strong uterine signal appears after the uterine-vulval connection is complete in adults. The gonadal signal, emanating from spermatids, migrates to the spermatheca around the time of the first ovulation. | |||
Expr10007 | The expression of TAT-2 was first detected in first larval stage worms (L1) in the intestine. From the L4 stage on through adulthood, the strongest GFP fluorescence could be detected in the intestine, the excretory canal cell and the spermatheca. However, expression was also seen in the pharyngeal procorpus, the excretory gland cell, the pharyngeal- intestinal valve, and the rectal gland cell. During the L4 stage, the signal was also seen in vulva cells and, around the timing of the first ovulation, it is also expressed in the proximal gonad. | |||
Expr12796 | tat-2 is expressed primarily in the excretory cell, spermatheca and intestine. | |||
Expr1153054 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015 | |||
Expr1021622 | Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012 | |||
Expr1038276 | Tiling arrays expression graphs | |||
Original chronogram file: chronogram.1791.xml | [H06H21.10:gfp] transcriptional fusion. | Chronogram753 | ||
Original chronogram file: chronogram.771.xml | [H06H21.10:gfp] transcriptional fusion. | Chronogram1852 | ||
Expr2017300 | Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans). |
22 GO Annotation
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
located_in | |
located_in | |
located_in | |
located_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables |
18 Homologues
Type |
---|
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
orthologue |
least diverged orthologue |
least diverged orthologue |
least diverged orthologue |
orthologue |
orthologue |
least diverged orthologue |
orthologue |
least diverged orthologue |
22 Ontology Annotations
Annotation Extension | Qualifier |
---|---|
enables | |
enables | |
enables | |
enables | |
enables | |
located_in | |
involved_in | |
involved_in | |
involved_in | |
involved_in | |
located_in | |
located_in | |
located_in | |
located_in | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables | |
enables |
1 Upstream Intergenic Region
WormBase ID | Name | Sequence Name | Length (nt) | Chromosome Location | Organism |
---|---|---|---|---|---|
intergenic_region_chrIV_4846894..4847290 | 397 | IV: 4846894-4847290 | Caenorhabditis elegans |