WormMine: Gene WBGene00001333

• WormBase Gene ID: WBGene00001333
• Gene Name: erm-1
• Sequence Name: C01G8.5
• Brief Description: erm-1 encodes the C. elegans ortholog of the ERM (Ezrin, Radixin, Moesin) family of cytoskeletal linkers; ERM-1 activity is required for regulating LET-23/EGFR receptor localization in the vulval cell lineages to effect proper temporal regulation of Ras-mediated EGF signaling.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cytoskeletal anchor activity and structural molecule activity. Involved in several processes, including actin filament organization; nematode larval development; and protein localization to basolateral plasma membrane. Located in actin filament; apical part of cell; and membrane-enclosed lumen. Expressed in several structures, including PVD; excretory canal; germ line; germline precursor cell; and uterine toroidal epithelial cell. Human ortholog(s) of this gene implicated in autosomal recessive nonsyndromic deafness 24 and immunodeficiency 50. Is an ortholog of human EZR (ezrin) and MSN (moesin).
• Biotype: SO:0001217
• Genetic Position: I :-0.159008 ±0.004512
• Length (nt): 7579

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001333

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C01G8.5a.1	C01G8.5a.1	2360	I: 5284026-5291604
Transcript:C01G8.5b.1	C01G8.5b.1	2290	I: 5284062-5290694

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C01G8.5a	C01G8.5a	1692	I: 5284598-5284690
CDS:C01G8.5b	C01G8.5b	1695	I: 5284598-5284690

28 RNAi Result

• WBRNAi00039365
• WBRNAi00024439
• WBRNAi00002881
• WBRNAi00024438
• WBRNAi00094172
• WBRNAi00071882
• WBRNAi00106081
• WBRNAi00114839
• WBRNAi00109565
• WBRNAi00063484
• WBRNAi00070978
• WBRNAi00066197
• WBRNAi00114823
• WBRNAi00109176
• WBRNAi00028313
• WBRNAi00116126
• WBRNAi00114627
• WBRNAi00080558
• WBRNAi00116796
• WBRNAi00065690
• WBRNAi00085790
• WBRNAi00109274
• WBRNAi00110578
• WBRNAi00066236
• WBRNAi00081117
• WBRNAi00109468
• WBRNAi00114840
• WBRNAi00109371

83 Allele

• gk962706
• gk963902
• WBVar01431586
• tm677
• gk720197
• gk877445
• gk342028
• gk524496
• gk782059
• gk377036
• gk755824
• gk873821
• gk496363
• gk743832
• gk471602
• gk797457
• gk849252
• gk902420
• gk553012
• gk734087
• gk552486
• gk877444
• gk848661
• gk779922
• gk467415
• gk407937
• gk361343
• gk347977
• gk655199
• gk343362

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001333
• Start: 5284026
• End: 5291604
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_5283945..5284025
• Length (nt): 81
• Chromosome Location: I: 5283945-5284025
• Organism: Caenorhabditis elegans

112 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_NoFood
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Transgeneration hypoxia treatment.	Transcripts that are significantly upregulated in F1 animals after P0 parents were exposed to 0.1% oxygen for 16 hours at L4 larva stage.	For calling the significant differentially expressed genes (DEGs),the false discovery rate (FDR) after multiple testing correction was set as 0.05 and analyzed in edgeR.	WBPaper00064871:hypoxia_upregulated_F1
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts detected in body muscle nuclei according to a nuclear FACS-based strategy.	Cufflinks	WBPaper00065120:body-muscle-transcriptome
Temprature shift to 28C for 24 hours.	Transcripts that showed significantly decreased expression after animals were exposed to 28C temperature for 24 hours.	Differentially expressed genes wereidentified using DESeq (v.1.18.0) by normalizing readsbased on the negative binomial distribution method andcomparing each HS timepoint to the 0-h control.	WBPaper00061341:28C_24h_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:intestine_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated

14 Expression Patterns

• Primary Identifier: Expr5099
• Remark: Also expressed in (comments from author) : quite a number of processes in head Strain: BC10874
• Reporter Gene: [erm-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAATTTGTTTTGTTTCAGCGTTTC] 3' and primer B 5' [TAGCTCTTTTTGATGTCCGAGTC] 3'.
• Pattern: Adult Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; excretory cell; Nervous System; head neurons; neurons along body; Larval Expression: pharyngeal-intestinal valve; rectal gland cells; anal sphincter; Reproductive System; developing uterus; developing spermatheca; excretory cell; Nervous System; head neurons; neurons along body; unidentified cells

• Primary Identifier: Expr1030813
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15173
• Subcellular Localization: In early embryogenesis, ERM-1::GFP localized to the entire plasma membrane as well as the cytoplasm. As morphogenesis initiates, ERM-1::GFP was primarily detected at the apical surface of epithelial tissues and in primordial germ cells (PGCs). In larval stages, we observed apical localization of ERM-1::GFP in epithelial tissues including the intestine, seam cells, and excretory canals. In the syncytial germline, ERM-1 was associated with the entire plasma membrane but enriched at the apical domain.

• Primary Identifier: Expr2964
• Remark: In situ RNA hybridization is consistent with this organ-specific expression pattern, and additionally detects early embryonic erm-1 RNA.
• Pattern: Expressed in embryos, larvae, and adults. ERM-1-GFP is enriched along the luminal surfaces of intestinal, excretory canal, and gonadal tubular epithelia, but not in the remaining organ lumina of the pharynx, rectum, and excretory pore cell, which all secrete cuticle.
• Subcellular Localization: Enriched along the luminal surfaces.

• Primary Identifier: Expr15174
• Subcellular Localization: In the syncytial germline, ERM-1 was associated with the entire plasma membrane but enriched at the apical domain.

• Primary Identifier: Expr2011368
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11990

• Primary Identifier: Expr2996
• Remark: Three different methods were used to show that the antiserum is specific for ERM-1. After RNAi depletion of ERM-1, immunological detection was greatly reduced or eliminated in embryonic extracts as well as in whole mount embryos. In addition, if whole mount WT embryos were incubated with an aliquot of antibodies that was preincubated with an excess of ERM-1 fusion protein before its use, no pattern of staining could be detected.
• Subcellular Localization: In wild type embryos, the first anti-ERM-1 staining was detect in the two-cell stage highlighting the cell cortex below contacting plasma membrane domains. This subcellular localization persists in most cells for the next rounds of division. At the onset of morphogenesis (lima bean stage), several tissues develop a polarized phenotype and ERM-1 becomes enriched at the apical cell cortex of the hypodermis and the pharyngeal-intestinal primordium. At the tadpole stage, the intestinal cells have fully polarized and feature an apical membrane domain that is marked by the co-localization of ERM-1 and the intermediate filament protein IFB-2. The apical membrane domain is separated from the basolateral membrane domain by AJM-1 expression, which marks the AJ. There is little or no overlap between ERM-1 and AJM-1 staining; however, ERM-1 co-localizes with apically enriched F-actin.

• Primary Identifier: Expr2029604
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr11779
• Pattern: In contrast to the apical localization observed in the intestine, an ERM-1::mCherry reporter showed basolateral and junctional localization and a partial overlap with LET-23::GFP in the VPCs and their descendants. Only after vulval invagination (at the Pn.pxxx stage), ERM-1 relocalized to the apical, luminal plasma membrane of the vulval toroids. The co-localization of LET-23 and ERM-1together with the in vitro protein interaction experiments suggested that both proteins form a complex at the basolateral membrane ofthe VPCs.

• Primary Identifier: Expr1010575
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1143481
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Chronogram979
• Remark: Original chronogram file: chronogram.2033.xml
• Reporter Gene: [C01G8.5:gfp] transcriptional fusion.

• Primary Identifier: Expr15172
• Subcellular Localization: In early embryogenesis, ERM-1::GFP localized to the entire plasma membrane as well as the cytoplasm. As morphogenesis initiates, ERM-1::GFP was primarily detected at the apical surface of epithelial tissues and in primordial germ cells (PGCs). In larval stages, we observed apical localization of ERM-1::GFP in epithelial tissues including the intestine, seam cells, and excretory canals. In the syncytial germline, ERM-1 was associated with the entire plasma membrane but enriched at the apical domain.

31 GO Annotation

13 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001333
• Start: 5284026
• End: 5291604
• Strand: -1

31 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 7579

1 Sequence Ontology Term