WormMine: Gene WBGene00001532

• WormBase Gene ID: WBGene00001532
• Gene Name: gcy-5
• Sequence Name: ZK970.6
• Brief Description: gcy-5 encodes a predicted guanylate cyclase with strong similarity to rat atrial natriuretic peptide receptor A; expressed in ASER.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable adenylate cyclase activity; guanylate cyclase activity; and peptide receptor activity. Involved in several processes, including chemosensory behavior; chemotaxis; and response to salt. Located in cilium. Expressed in ASER; amphid neurons; head neurons; and nervous system.
• Biotype: SO:0001217
• Genetic Position: II :2.41972 ±0.012024
• Length (nt): 5820

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001532

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:ZK970.6.1	ZK970.6.1	3369	II: 10310400-10316219

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK970.6	ZK970.6	3369	II: 10310400-10310800

5 RNAi Result

• WBRNAi00059862
• WBRNAi00022251
• WBRNAi00022252
• WBRNAi00038516
• WBRNAi00095452

89 Allele

• gk963801
• gk963053
• gk962682
• WBVar01696267
• WBVar01604600
• WBVar01604601
• WBVar01604602
• WBVar01604603
• tm897
• WBVar01439440
• WBVar01375598
• h7189
• ot835
• WBVar00268940
• WBVar01505054
• gk490407
• gk871388
• gk355527
• gk851027
• gk319913
• gk833848
• ok921
• gk855810
• gk754287
• ttTi40637
• gk487439
• ok930
• gk456636
• gk738495
• WBVar00175025

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001532
• Start: 10310400
• End: 10316219
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_10310069..10310399
• Length (nt): 331
• Chromosome Location: II: 10310069-10310399
• Organism: Caenorhabditis elegans

79 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
	Upregulated mRNAs and lncRNAs in dot-1.1(knu339); ced-3(n1286) relative to ced-3(n1286).	edgeR, fold change > 2, FDR < 0.05.	WBPaper00065759:dot-1.1(knu339)_upregulated
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly increased expression in ngn-1(ok2200) embryos comparing to in N2.	DESeq2 ver.3.4.1	WBPaper00059537:ngn-1(ok2200)_upregulated
	Transcripts that showed significantly increased expression in BAT525 [hmg-3 (tm2539) / dpy-5(e61) unc-13(e1091) I.] comparing to in N2 at 1-day post L4 adult hermaphrodite stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:hmg-3(bar24)_upregulated
	Transcripts that showed significantly increased expression in spt-16(RNAi) comparing to in vector control worm at L4 larva stage.	DESeq 2, fold change > 4, adjusted p-value < 0.05.	WBPaper00055013:spt-16(RNAi)_upregulated
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:eat-2(ad1116)_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in dpy-21(e428) comparing to in N2 during L3 stage.	DESeq v1.6.3. Fold change > 1.5.	WBPaper00050370:dpy-21(e428)_L3_upregulated
	Transcripts that showed significantly increased expression in blmp-1(tm548) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00062347:blmp-1(tm548)_upregulated
Fungi infection: Haptoglossa zoospora.	Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours.	Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01.	WBPaper00062354:H.zoospora_6h_regulated
	Transcripts that showed significantly decreased expression in set-2(tm1630) animals at embryo stage, comparing to in N2 animals.	DESeq2 (v2.1.8.3) was used to determine DE genes and to generate principal component and scatter plots. DE genes with FDR < 0.05 were analysed using g:Profiler with Bonferroni correction.	WBPaper00060014:set-2(tm1630)_downregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in nas-38(ok3407) comparing to in N2.	A feature was classified upregulated if its FDR-corrected p-value was <= 0.05 and fold change was >= 2. Analogously, a gene was classified downregulated if its FDR-corrected p-value was <= 0.05 and fold change was <= -2.	WBPaper00060703:nas-38(ok3407)_upregulated
	Genome-wide analysis of developmental and sex-regulated gene expression profile.	self-organizing map	cgc4489_group_12
	Transcripts that showed significantly increased expression in zip-3(gk3164) comparing to in N2, after exposed to P. aeruginosa for 18 hours.	p < 0.05	WBPaper00056326:zip-3(gk3164)_upregulated_P.aeruginosa-infected
	Transcripts that showed significantly increased expression in sma-4(rax3) comparing to in N2 at 1-day post-L4 adult hermaphrodite	HTseq-count was used to count reads mapped to each gene and counting data was imported to EdgeR for statistical analysis. Statistical significance was defined by adjusted P value (false discovery rate, FDR) of <0.05.	WBPaper00053184:sma-4(rax3)_upregulated
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
	Transcripts that showed significantly increased expression in animals after 24 hours of exposure to 300mM NaCl comparing to control animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_24h-NaCl
	Transcripts that showed significantly increased expression in dpy-7(e88) animals comparing to N2 animals.	Authors considered genes differentially expressed if they had a q-value <= 0.05 and a b-value >= 1 or <= -1.	WBPaper00053771:up_at_dpy-7(e88)
	Genes that showed significantly decreased experssion after 22.5 hours of treatment in 200nM delta7-dafachronic acid comparing with in ethanol vehicle control.	To identify the differentially expressed genes, we applied Significance Analysis of Microarrays (SAM) analysis using the R package samr [46]. Genes with median false discovery <5% and fold changes >2.0 were considered differentially expressed.	WBPaper00046548:dafachronic-acid_downregulated
feeding/starvation	A large cluster of genes up-regulated during early larval development..	For each average expression value, the larger of the model-based error and empirical error was reported. ANOVA and T-tests were also computed in Rosetta Resolver using the reported errors. Expression values, errors, and P-values corresponding to transcript detection, ANOVAs, and T-tests were exported from Rosetta Resolver and analyzed elsewhere.	WBPaper00032948:FedUp

9 Expression Patterns

• Primary Identifier: Expr1163287
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Marker14
• Remark: Picture: N.A.
• Pattern: Expressed in ASER.

• Primary Identifier: Marker67
• Remark: Picture: N.A. Reporter gene fusion type not specified.
• Pattern: marker for ASER neuron.

• Primary Identifier: Expr238
• Remark: About 3 kb upstream of predicted coding region. Orphan guanylyl cyclase receptor. Injected lin-15(n765ts) strain. Transgenic Marker: lin-15+.
• Pattern: Expressed in ASER at unspecified postembryonic stage.

• Primary Identifier: Expr14779

• Primary Identifier: Expr7269
• Remark: Strain: BC11009
• Reporter Gene: [gcy-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTGGGCGTAGTGCAAGC] 3' and primer B 5' [TATAGAAGCCGGATTTTTCATCA] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; amphids; Larval Expression: Nervous System; head neurons; amphids

• Primary Identifier: Chronogram815
• Remark: Original chronogram file: chronogram.1856.xml
• Reporter Gene: [ZK970.6:gfp] transcriptional fusion.

• Primary Identifier: Expr2030237
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2012001
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

23 GO Annotation

19 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001532
• Start: 10310400
• End: 10316219
• Strand: -1

23 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5820

1 Sequence Ontology Term