WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00001876 Gene Name  his-2
Sequence Name  ? T10C6.13 Brief Description  his-2 encodes an H3 histone; his-2 is contained within the histone gene cluster HIS1.
Organism  Caenorhabditis elegans Automated Description  Enables methylated histone binding activity. Predicted to be located in chromosome and nucleus. Predicted to be part of nucleosome. Is an ortholog of several human genes including H3C1 (H3 clustered histone 1); H3C3 (H3 clustered histone 3); and H3C4 (H3 clustered histone 4).
Biotype  SO:0001217 Genetic Position  V :9.38828 ±0.003939
Length (nt)  ? 411
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00001876

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:T10C6.13.1 T10C6.13.1 411   V: 16041873-16042283
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:T10C6.13 T10C6.13 411   V: 16041873-16042283

20 RNAi Result

WormBase ID
WBRNAi00095670
WBRNAi00044891
WBRNAi00025512
WBRNAi00026260
WBRNAi00064495
WBRNAi00064612
WBRNAi00064766
WBRNAi00090822
WBRNAi00090829
WBRNAi00053027
WBRNAi00068672
WBRNAi00068673
WBRNAi00068674
WBRNAi00068670
WBRNAi00068671
WBRNAi00025853
WBRNAi00069048
WBRNAi00081663
WBRNAi00111729
WBRNAi00111747

19 Allele

Public Name
gk963271
gk964458
gk964459
WBVar02124626
WBVar02124261
WBVar02122682
WBVar02124830
WBVar02124905
WBVar02123702
WBVar02121632
WBVar02123703
gk257128
WBVar01632408
WBVar01632409
WBVar01632410
gk563693
gk452487
gk596879
gk401859

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00001876 16041873 16042283 -1

4 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  
Panther orthologue and paralogue predictions  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_16041192..16041872   681 V: 16041192-16041872 Caenorhabditis elegans

126 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  oocyte proteins identified by two or more unique peptides during proteomics study. In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide. WBPaper00038289:oocyte_protein
  Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons. DESeq. False discovry rate (FDR) < 0.1. WBPaper00048988:neuron_expressed
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when no food was present DESeq(version 1.10.1), FDR < 0.05. WBPaper00050726:OsmoticStress_regulated_NoFood
  Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C. DESeq2, fold change > 2, p-value < 0.05. WBPaper00061753:csr-1(tor159)_upregulated_25C
  Transcripts that showed significantly increased expression in ogt-1(ok1474) neuronal cells isolated by FACs comparing to in FACs isolated neuronal cells from wild type. DESeq2, fold change > 2, FDR < 0.05. WBPaper00066485:ogt-1(ok1474)_upregulated_neuron
  Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc). DESeq2, fold change >= 2, FDR <= 0.01. WBPaper00056826:SGP_biased
  Developmentally modulated gene cluster. self-organizing map cgc4386_cluster_1_5
  Maternal class (M): genes that are called present in at least one of the three PC6 replicates. A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing. [cgc5767]:expression_class_M
  Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_developing
  Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2. DESeq2, Fold change > 1.5. WBPaper00051404:alg-1(gk214)_upregulated
  Transcripts that showed significantly decreased expression in daf-16(mgDf50) comparing to in N2 at L1 larva stage. DESeq v1.20.0 was used to analyze differential gene expression. Transcripts with adjusted p-value < 0.05 were considered differentialled expressed. WBPaper00048971:daf-16(mgDf50)_downregulated_L1
  Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_oocyte_depleted
  Transcripts depleted in purified oocyte P bodies comparing to in the whole animal. DESeq2, FDR < 0.05, fold change > 2. WBPaper00065975:P-body_vs_WholeAnimal_depleted
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva. Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage. DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3. WBPaper00058958:100mGy-irradiation-72h_upregulated
  Genes that showed oscillating mRNA expression level throughout the 16 hour time courses from L3 larva to young adult. The following three lines of R code were used to perform the classification: increasing <-2*amplitude-PC1 < -1.7; oscillating <-!increasing & (amplitude > 0.55); flat <-!increasing & !oscillating; Note that the amplitude of a sinusoidal wave corresponds to only half the fold change between trough and peak. WBPaper00044736:oscillating_dev_expression
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:coelomocytes_L2-larva_expressed
  Transcripts that showed significantly increased expression in mbl-1(syb4345), referred to as mbl-1long(ex7+), comparing to in N2 at L4 larva stage. DESeq2, Fold change > 2 and FDR < 0.05 WBPaper00066410:mbl-1(syb4345)_upregulated
  Transcripts that showed significantly increased expression in mep-1(ne4629[MEP-1-GFP-Degron]) in gonads dissected from 1-day old adult animals. Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R. WBPaper00061479:mep-1(ne4629)_upregulated
  Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
  Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference). A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes. WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
  Transcripts that showed significantly decreased expression in eat-2(ad1116) comparing to in N2 at 3-days post L4 adult hermaphrodite animals. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:eat-2(ad1116)_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Psora-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Metformin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rapamycin-Rifampicin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin-Allantoin_downregulated
  Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite. DESeq2(v1.14.1), fold change > 2, p-value < 0.05 WBPaper00055354:Rifampicin_downregulated
Bacteria: B.thuringiensis Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
Bacteria: B.thuringiensis Transcripts in N2 animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407. Cuffdiff WBPaper00060358:B.thuringiensis_pathogen_regulated_N2

8 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
    Expr4223 In wild type, anti-H3K36me2 staining is in all nuclei of the germ line, and also in somatic gut nuclei. Expressed in nuclei.
    Expr1031104 Tiling arrays expression graphs  
Strain: BC14501 [his-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTACGTTTGAACTTGGAAAATG] 3' and primer B 5' [TGGAATCCGATAAGGACTGTG] 3'. Expr6659 Larval Expression: Reproductive System; developing vulva;  
Original chronogram file: chronogram.813.xml [T10C6.13:gfp] transcriptional fusion. Chronogram1898    
    Expr2030682 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr2012446 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
Original chronogram file: chronogram.795.xml [T10C6.13:gfp] transcriptional fusion. Chronogram1878    
    Expr1156627 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

12 GO Annotation

Annotation Extension Qualifier
  enables
  enables
  enables
  part_of
  located_in
  part_of
  located_in
  located_in
  enables
  located_in
  enables
  enables

5 Homologues

Type
least diverged orthologue
least diverged orthologue
orthologue
least diverged orthologue
least diverged orthologue

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00001876 16041873 16042283 -1

12 Ontology Annotations

Annotation Extension Qualifier
  enables
  enables
  enables
  part_of
  located_in
  part_of
  located_in
  located_in
  enables
  located_in
  enables
  enables

0 Regulates Expr Cluster

1 Sequence

Length
411

1 Sequence Ontology Term