WormMine: Gene WBGene00003014

• WormBase Gene ID: WBGene00003014
• Gene Name: lin-28
• Sequence Name: F02E9.2
• Brief Description: lin-28 encodes a cytoplasmic protein with a cold shock domain and retroviral-type (CCHC) zinc finger motifs; LIN-28 is required for events specific to the second larval stage, which in lin-28 mutants are skipped, and is itself subject both to negative regulation (by binding of the lin-4 stRNA to an element in the lin-28 3' UTR) and to positive regulation (by LIN-14, which negatively regulates lin-4-independent inhibition also acting on the lin-28 3' UTR).
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA binding activity and enzyme binding activity. Involved in several processes, including regulation of cell fate specification; regulation of development, heterochronic; and regulation of gene expression. Located in cytoplasm and nucleus. Expressed in germ line; hypodermis; muscle cell; nervous system; and neurons. Is an ortholog of human LIN28A (lin-28 homolog A).
• Biotype: SO:0001217
• Genetic Position: I :2.79097 ±0.009013
• Length (nt): 3175

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003014

Genomics

2 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F02E9.2b.1	F02E9.2b.1	1311	I: 8407630-8409920
Transcript:F02E9.2a.1	F02E9.2a.1	1214	I: 8407632-8410804

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F02E9.2a	F02E9.2a	684	I: 8408161-8408496
CDS:F02E9.2b	F02E9.2b	591	I: 8408161-8408496

26 RNAi Result

• WBRNAi00043826
• WBRNAi00093870
• WBRNAi00003322
• WBRNAi00069764
• WBRNAi00027705
• WBRNAi00065500
• WBRNAi00065501
• WBRNAi00107360
• WBRNAi00065502
• WBRNAi00086953
• WBRNAi00086053
• WBRNAi00086955
• WBRNAi00086052
• WBRNAi00086954
• WBRNAi00086957
• WBRNAi00086054
• WBRNAi00087212
• WBRNAi00086956
• WBRNAi00116840
• WBRNAi00087767
• WBRNAi00087770
• WBRNAi00087772
• WBRNAi00075402
• WBRNAi00087776
• WBRNAi00087778
• WBRNAi00087175

50 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• WBVar00244026
• gk412591
• gk477403
• ga73
• gk358919
• gk315885
• gk675677
• WBVar01832214
• gk315384
• gk659593
• gk929677
• gk869492
• gk763041
• gk860430
• gk842153
• gk462258
• ot1153
• ot1154
• ot1155
• WBVar01403247
• tm4566
• WBVar00155050
• gk954645
• gk116855
• gk116856

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003014
• Start: 8407630
• End: 8410804
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

149 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Genes significantly enriched in NSM neurons (isolated by FACS) versus the reference, according to RNAseq analysis towards total RNA.	Gene expression quantification and differential expression was analyzed using cufflinks v2.2.1. Enriched contains only genes significantly enriched (differentially expressed >= 2.4 fold in total RNA or >= 3.2 fold in DSN treated total RNA) in the NSM neurons versus the reference.	WBPaper00045974:NSM_enriched_totalRNA_RNAseq
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L3-L4-larva_expressed
	Transcripts that showed significantly increased expression in ilc-17.1(syb5296) comparing to in N2 animals at L4 larva stage.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00066594:ilc-17.1(syb5296)_upregulated
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral

17 Expression Patterns

• Primary Identifier: Expr1031407
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5665
• Remark: Strain: BC14203
• Reporter Gene: [lin-28::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTTTGGCCTTAAACAATTCG] 3' and primer B 5' [ACTACCGTCGAGATCCTGAAAA] 3'.
• Pattern: Adult Expression: pharynx; Reproductive System; vulval muscle; body wall muscle; unidentified cells in body ; Larval Expression: pharynx; body wall muscle

• Primary Identifier: Expr1617
• Pattern: Expression of lin-28:GFP is greatest in late embryos and L1 larvae, detectable but diminished in the L2, and greatly diminished by the L3 and L4 stages. None of the animals that were fluorescing at the L1 did so at the L4 stage. Some neuron cell bodies, particularly those in the head, can occasionally be seen fluorescing weakly in late stages, and fluorescence in hypodermis and muscle is generally undetectable in L3-stage or older animals. In transgenic L1 larvae, fluorescence can be seen in diverse cell types, including hypodermis, muscle, and neurons, but not in the germline. Lineages that are abnormal in lin-28 mutants, such as lateral and ventral hypodermis, express the lin-28:GFP fusion. Other cell types, such as head neurons and body muscle also express lin-28:GFP. The fluorescence is most intense in neurons and occasionally in hypodermal blast cells, and is often weak in or absent from the intestine. Northern and RNase protection analysis reveals that the lin-28 mRNA is present throughout postembryonic development.
• Subcellular Localization: The fluorescence is in the cytoplasm in all of these cells, though occasionally fluorescence can be detected in some nuclei or nucleoli.

• Primary Identifier: Expr14270
• Pattern: The endogenous lin-28 promoter drives lin-28::GFP expression in neurons and hypodermis, where lin-28 is known to be expressed (Moss et al., 1997). Using spinning disk microscopy we also detected lin-28p::lin-28::GFP expression in Z1 and Z4 cells, which are precursors of somatic gonadal tissues.

• Primary Identifier: Expr10644
• Pattern: lin-28 mRNA germline expression was validated by RNA-seq and PCR on dissected gonads.

• Primary Identifier: Expr14648
• Pattern: Consistent with previous reporter gene analysis (Moss et al., 1997), we found that a fosmid-based reporter construct of the lin-28 gene is expressed very broadly in the nervous system in a sexually non-dimorphic manner and downregulated by the end of the L2 stage.

• Primary Identifier: Expr2013171
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1832
• Pattern: All forms of LIN-28 were abundant during the L1 stage and decreased to their lowest levels by the L3 stage (3036 h). Titration experiments revealed that the decrease in LIN-28 protein level from 12 to 30 h of larval development was between 10- and 20-fold.

• Primary Identifier: Expr13376
• Pattern: In WT animals, LIN-28 is highly expressed upon hatching and during the L1 stage, and expression decreases throughout development, so that by the L3 it reduced 10- to 20-fold.

• Primary Identifier: Expr1833
• Remark: Type: RNase-Protection Assay.
• Pattern: The level of lin-28 mRNA was constant over the entire period examined, from the start of the L1 (6 h) to the early- to mid-L3 (36 h).

• Primary Identifier: Expr15683
• Pattern: The expression pattern of endogenously tagged LIN-28::GFP is similar to that reported previously for a transgene expressing tagged LIN-28 (Moss et al., 1997): LIN-28 is highly expressed in embryos and in L1- and L2-stage larvae and is diminished at subsequent larval stages.

• Primary Identifier: Expr2031403
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1027342
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr3205
• Pattern: No expression.

• Primary Identifier: Expr1147802
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr4080
• Remark: Curated by authors based on online in-situ hybridization database (Y. Kohara, personal communication; http://nematode.lab.nig.ac.jp).
• Pattern: Expressed in faint staining.

• Primary Identifier: Chronogram1784
• Remark: Original chronogram file: chronogram.698.xml
• Reporter Gene: [F02E9.2:gfp] transcriptional fusion.

30 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003014
• Start: 8407630
• End: 8410804
• Strand: -1

30 Ontology Annotations

3 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in lin-28(RNAi) animals comparing to in control animals.	Cuffdiff was used to search for the differentially expressed genes (FDR < 0.1).	WBPaper00050234:lin-28(RNAi)_downregulated
	Transcripts that showed significantly increased expression in lin-28(RNAi) animals comparing to in control animals.	Cuffdiff was used to search for the differentially expressed genes (FDR < 0.1).	WBPaper00050234:lin-28(RNAi)_upregulated
	MicroRNA that showed differential expression for more than 1.5 fold in the absence of lin-28.	Paired t-test. Genes with p-value < 0.05 and fold change >= 1.5 were considered differentially expressed.	WBPaper00040932:lin-28_regulated_microRNA

1 Sequence

• Length: 3175

1 Sequence Ontology Term