WormMine: Gene WBGene00006831

• WormBase Gene ID: WBGene00006831
• Gene Name: unc-104
• Sequence Name: C52E12.2
• Brief Description: unc-104 encodes a kinesin-like motor protein homologous to human axonal transporter of synaptic vesicles (ATSV, OMIM: 601255); UNC-104 is required for anterograde axonal transport of synaptic vesicles as well as differentiation of pre- and postsynaptic domains at inhibitory neuromuscular junctions; UNC-104 is expressed solely in neurons; UNC-104 retrograde movement is regulated by PTL-1/Tau, with which it physically interacts in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Enables cytoskeletal protein binding activity; phosphatidylinositol phosphate binding activity; and plus-end-directed microtubule motor activity. Involved in several processes, including chemical synaptic transmission; regulation of cellular component organization; and regulation of cellular localization. Located in axon; presynapse; and somatodendritic compartment. Expressed in epithelial cell; muscle cell; neurons; and somatic nervous system. Human ortholog(s) of this gene implicated in several diseases, including autoimmune disease of the nervous system (multiple); carcinoma (multiple); and neuropathy (multiple). Is an ortholog of human KIF1A (kinesin family member 1A).
• Biotype: SO:0001217
• Genetic Position: II :0.210467 ±0.00612
• Length (nt): 15639

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006831

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C52E12.2b.1	C52E12.2b.1	5502	II: 6994987-7010624
Transcript:C52E12.2a.1	C52E12.2a.1	5306	II: 6995051-7010624
Transcript:C52E12.2a.2	C52E12.2a.2	5173	II: 6995932-7010625

Other

2 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C52E12.2a	C52E12.2a	4755	II: 6995934-6996033
CDS:C52E12.2b	C52E12.2b	4887	II: 6995934-6996033

12 RNAi Result

• WBRNAi00089805
• WBRNAi00043032
• WBRNAi00008545
• WBRNAi00114359
• WBRNAi00086129
• WBRNAi00092956
• WBRNAi00089271
• WBRNAi00089270
• WBRNAi00090031
• WBRNAi00090190
• WBRNAi00090349
• WBRNAi00114350

221 Allele

• gk963801
• gk963053
• rh43
• rh126
• rh142
• rh1017
• rh1016
• gk345906
• tm819
• otn17719
• snx2236
• otn1395
• snx370
• otn11963
• WBVar01604113
• WBVar01438338
• WBVar01438340
• WBVar01438341
• WBVar01438348
• WBVar01438346
• WBVar01438347
• WBVar01438344
• WBVar01438345
• WBVar01374878
• gk848287
• gk786574
• gk744568
• gk878523
• gk692299
• gk617738

1 Chromosome

• WormBase ID: II
• Organism: Caenorhabditis elegans
• Length (nt): 15279421

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006831
• Start: 6994987
• End: 7010625
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrII_7010626..7010797
• Length (nt): 172
• Chromosome Location: II: 7010626-7010797
• Organism: Caenorhabditis elegans

229 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade).	Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118.	WBPaper00040858:eQTL_regulated_reproductive
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR

15 Expression Patterns

• Primary Identifier: Expr2035970
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5571
• Remark: Strain: BC10099
• Reporter Gene: [unc-104::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCC GAA AAT TCG AGA AAC AA] 3' and primer B 5' [GAATTCGTTCGTAGAAATTGGA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; tail neurons

• Primary Identifier: Expr5572
• Remark: Strain: BC12955
• Reporter Gene: [unc-104::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCGAAAATTCGAGAAACAA] 3' and primer B 5' [GAATTCGTTCGTAGAAATTGGA] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr15243

• Primary Identifier: Expr14256
• Pattern: We visualized overlapping UNC-104/ dynein localization in axons and sublateral neurons by performing line scans along axons. UNC-104 localization often overlaps with dynein localization, though, occasionally, UNC-104 alone can be detected. Further, UNC-104 co-localization with dynein can be sometimes observed at axonal branch points.

• Primary Identifier: Expr9356
• Pattern: The unc-104p::GFP transgene was expressed in many head neurons, including DsRed-labeled AWC neurons.
• Subcellular Localization: UNC-104::GFP was localized in a punctate pattern along the AWC axons and diffuse in the cell body.

• Primary Identifier: Expr1032894
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1336
• Remark: late embryo (author) = fully-elongated embryo (curator)
• Pattern: UNC-104::GFP was expressed consistently throughout the nervous system. Distinct fluorescence was observed in neurons in the head, in the nerve ring, in the nerve cords, around the vulva, and in the tail. UNC-104::GFP was expressed during most stages of development, from late embryo to adult. Although the overall expression pattern was similar in all transgenic animals, variability was observed in the actual amount of fluorescent protein that was expressed.
• Subcellular Localization: UNC-104::GFP was found in neuronal processes and the cytoplasm, but not in nuclei. In some cases, the neuronal processes could be classified into either axons or dendrites, but there were no recognizable differences in UNC-104 expression between axons and dendrites.

• Primary Identifier: Expr12740
• Pattern: The UNC-104::mCherry signal is specifically decreased in the DNC, but not VNC, of day 12 and day 18 animals compared to that of day 1, indicative of compromised UNC-104 activity and kinesin motor's failure to travel to distal axons with age.

• Primary Identifier: Expr11471
• Pattern: Wild- type animals exhibited a consistent distribution of UNC-104 fluorescence in PLM, with a smooth increase in expression along the axon in a proximal-to-distal fashion, and pooling at the distal end and at presynaptic sites.

• Primary Identifier: Chronogram790
• Remark: Original chronogram file: chronogram.1830.xml
• Reporter Gene: [C52E12.2:gfp] transcriptional fusion.

• Primary Identifier: Expr1146994
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2017834
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1013981
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Chronogram2003
• Remark: Original chronogram file: chronogram.916.xml
• Reporter Gene: [C52E12.2:gfp] transcriptional fusion.

72 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006831
• Start: 6994987
• End: 7010625
• Strand: 1

72 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 15639

1 Sequence Ontology Term