WormMine: Gene WBGene00022861

• WormBase Gene ID: WBGene00022861
• Gene Name: dve-1
• Sequence Name: ZK1193.5
• Brief Description: dve-1 encodes, by alternative splicing, three proteins with a COMPASS (CMP) domain and two homeodomains; dve-1 interacts with two or more components of the EGF/RAS signallingpathway, and is required for such signalling in vulval development; the CMP domain is found in the N-terminus of SATB-class CUT homeodomain proteins (e.g. human SATB1), and in Drosophila DEFECTIVE PROVENTRICULUS (DVE), to which DVE-1 may be orthologous; both DVE and dve-1 encode two homeodomains which are highly divergent, but homologous between species, and probably derived by intragenic duplication; dve-1 is required for a normally high rate of growth, fluid excretion, and larval viability in in mass RNAi assays.
• Organism: Caenorhabditis elegans
• Automated Description: Enables DNA-binding transcription activator activity, RNA polymerase II-specific; enzyme binding activity; and protein-folding chaperone binding activity. Involved in embryo development; mitochondrial unfolded protein response; and regulation of innate immune response. Located in cytosol and nucleus. Part of chromatin and transcription regulator complex. Expressed in several structures, including neurons; rectum; somatic nervous system; tail; and vulva. Human ortholog(s) of this gene implicated in SATB2-associated syndrome. Is an ortholog of human SATB1 (SATB homeobox 1) and SATB2 (SATB homeobox 2).
• Biotype: SO:0001217
• Genetic Position: X :-19.8977 ±0.032426
• Length (nt): 6778

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00022861

Genomics

10 Transcripts

Class	WormMine ID	Sequence Name	Length (nt)	Chromosome Location
MRNA	Transcript:ZK1193.5d.3	ZK1193.5d.3	2414	X: 427035-433516
MRNA	Transcript:ZK1193.5d.1	ZK1193.5d.1	2069	X: 427035-433812
MRNA	Transcript:ZK1193.5d.5	ZK1193.5d.5	1626	X: 427038-431985
MRNA	Transcript:ZK1193.5d.4	ZK1193.5d.4	1847	X: 427040-432260
MRNA	Transcript:ZK1193.5d.2	ZK1193.5d.2	2049	X: 427040-433788
MRNA	Transcript:ZK1193.5c.1	ZK1193.5c.1	2394	X: 427048-433500
MRNA	Transcript:ZK1193.5a.1	ZK1193.5a.1	2050	X: 427050-433799
MRNA	Transcript:ZK1193.5c.2	ZK1193.5c.2	2248	X: 427172-432784
MRNA	Transcript:ZK1193.5e.1	ZK1193.5e.1	1398	X: 427687-433793
NcPrimaryTranscript	Transcript:ZK1193.5b	ZK1193.5b	2101	X: 427687-433793

Other

4 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:ZK1193.5a	ZK1193.5a	1407	X: 427687-427770
CDS:ZK1193.5c	ZK1193.5c	783	X: 427687-427770
CDS:ZK1193.5e	ZK1193.5e	1398	X: 427687-427770
CDS:ZK1193.5d	ZK1193.5d	774	X: 427687-427770

56 RNAi Result

• WBRNAi00095827
• WBRNAi00009455
• WBRNAi00084554
• WBRNAi00107477
• WBRNAi00059154
• WBRNAi00105958
• WBRNAi00108505
• WBRNAi00092104
• WBRNAi00084576
• WBRNAi00092122
• WBRNAi00093157
• WBRNAi00092004
• WBRNAi00093159
• WBRNAi00093160
• WBRNAi00093165
• WBRNAi00064784
• WBRNAi00093166
• WBRNAi00093168
• WBRNAi00110215
• WBRNAi00093170
• WBRNAi00107528
• WBRNAi00093185
• WBRNAi00064549
• WBRNAi00110232
• WBRNAi00093190
• WBRNAi00110237
• WBRNAi00107164
• WBRNAi00093327
• WBRNAi00107424
• WBRNAi00093329

104 Allele

• gk963652
• gk963725
• WBVar01600293
• WBVar01600292
• WBVar00074275
• WBVar00074274
• WBVar00074273
• WBVar00074272
• WBVar00074271
• WBVar00074270
• tm259
• WBVar01978998
• gk442151
• gk619300
• gk736829
• gk421510
• gk497322
• gk834069
• gk337797
• gk574176
• gk522529
• gk416060
• gk371283
• gk792587
• gk541956
• gk693202
• gk788670
• gk373052
• gk398779
• gk643445

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00022861
• Start: 427035
• End: 433812
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_425636..427034
• Length (nt): 1399
• Chromosome Location: X: 425636-427034
• Organism: Caenorhabditis elegans

179 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
	Transcripts that showed significantly increased expression in sftb-1(cer6) deletion homozygous comparing to to in N2 animals at L4 larva stage.	DESeq2, fold change > 2	WBPaper00058725:sftb-1(cer6)_downregulated
	Transcripts that showed significantly increased expression in xrep-4(lax137).	DESeq2. Genes were selected if their p value < 0.01.	WBPaper00066062:xrep-4(lax137)_upregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in N2.	Differential gene expression analysis was performed using the quasi-likeli-hood framework in edgeR package v. 3.20.1 in R v. 3.4.1.	WBPaper00053810:daf-2(e1370)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
Bacteria infection: Staphylococcus aureus	mRNAs that showed increased expression 8 hours after N2 animals were infected by S. aureus.	DESeq, p <= 0.05	WBPaper00045314:S.aureus-induced_N2
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed significantly increased expression in srbc-48(ac23);kyIs262;fer-1(b232ts) comparing to in kyIs262;fer-1(b232ts), 24h after infection with P.aeruginosa.	DESeq2, FDR <0.05, fold change > 2.	WBPaper00059664:srbc-48(ac23)_upregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Psora and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Psora-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Allantoin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_downregulated
	Transcripts that showed significantly decreased expression after animals were treated with 50uM Rifampicin and 250uM Allantoin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin-Allantoin_downregulated
	Transcripts that showed significantly increased expression in pqm-1(ok485) animals after exposure to 5mM CoCl2 for 6hours, comparing to in N2 animals with the same exposure to CoCl2.	Significant differentially-expressed gene sets were identified using one or two-class SAM.	WBPaper00060399:pqm-1(ok485)_upregulated_CoCl2_6hr

13 Expression Patterns

• Primary Identifier: Expr4998
• Remark: Picture: Figure 2A. The validity of the anti-DVE-1 staining is supported by the diminished signal in embryos born to dve-1(RNAi) mothers and by its concordance with the fluorescent signal in embryos expressing a dve-1::gfp transgene controlled by the endogenous promoter (dve-1pr::dve-1::gfp).
• Pattern: Most cells had some DVE-1 staining, but the strongest signal was observed in the mitochondria-rich intestinal precursor cells.
• Subcellular Localization: Immunostaining of embryos with antiserum raised to bacterially expressed DVE-1 revealed a signal that colocalized with the DNA-binding dye Hoechst H33258, indicating nuclear localization of the endogenous protein.

• Primary Identifier: Expr15619

• Primary Identifier: Expr7192
• Remark: Strain: BC14571
• Reporter Gene: [ZK1193.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCCCTCTCTCTCTCTCTCT] 3' and primer B 5' [CCTCATTGGGAAGATATCTAGCTG] 3'.
• Pattern: Adult Expression: pharynx; arcade cells; intestine; rectal epithelium; Nervous System; head neurons; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; arcade cells; intestine; rectal epithelium; Nervous System; head neurons; tail neurons; unidentified cells in tail

• Primary Identifier: Expr2029358
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1162575
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2011122
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1040114
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr1200315
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Chronogram978
• Remark: Original chronogram file: chronogram.2032.xml
• Reporter Gene: [ZK1193.5:gfp] transcriptional fusion.

• Primary Identifier: Expr7757
• Remark: Clone: pUL#JRH10F4
• Pattern: Expression observed from early embryo to adult. Early and mid embryo expression assumed to be intestinal precursors as intestine expression seen later. Also in rectum and sometimes in pharynx. Dorsal nerve cord, subset of ventral nerve cord, and several amphids. Also vulval expression.

• Primary Identifier: Expr10276
• Pattern: Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr10277
• Pattern: Inferred expression. EPIC dataset. http://epic.gs.washington.edu/ Large-scale cellular resolution compendium of gene expression dynamics throughout development. This reporter was inferred to be expressing in this cell or one of its embryonic progenitor cells as described below. To generate a compact description of which cells express a particular reporter irrespective of time, the authors defined a metric "peak expression" for each of the 671 terminal ("leaf") cells born during embryogenesis. For each of these cells, the peak expression is the maximal reporter intensity observed in that cell or any of its ancestors; this has the effect of transposing earlier expression forward in time to the terminal set of cells. This metric allows straightforward comparisons of genes' cellular and lineal expression overlap, even when the expression occurs with different timing and despite differences in the precise time point that curation ended in different movies, at the cost of ignoring the temporal dynamics of expression, a topic that requires separate treatment. For simplicity, the authors use the term "expressing cells" to mean the number of leaf cells (of 671) with peak expression greater than background (2000 intensity units) and at least 10% of the maximum expression in that embryo. Quantitative expression data for all cells are located here: ftp://caltech.wormbase.org/pub/wormbase/datasets-published/murray2012/

• Primary Identifier: Expr1025598
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

26 GO Annotation

8 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00022861
• Start: 427035
• End: 433812
• Strand: -1

26 Ontology Annotations

2 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins that interact with DVE-1-GFP in cco-1(RNAi) animals, according to immunoprecipitation followed with mass spectrometry.	N.A.	WBPaper00060084:DVE-1_interacting_protein_cco-1(RNAi)
	Proteins that interact with DVE-1-GFP in animals injected with empty vector, according to immunoprecipitation followed with mass spectrometry.	N.A.	WBPaper00060084:DVE-1_interacting_protein_control

1 Sequence

• Length: 6778

1 Sequence Ontology Term