WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Larval Expression: stomato-intestinal muscle; Reproductive System; distal tip cell; body wall muscle; head mesodermal cell; Nervous System; neurons along body; Primary Identifier  Expr5460
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC14164 Reporter Gene  [C37C3.6b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003242 mig-6 C37C3.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023