WormMine: ExpressionPattern Expr5388

• Pattern: Adult Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; spermatheca; hypodermis; Nervous System; ventral nerve cord; head neurons; Larval Expression: pharynx; anal depressor muscle; rectal epithelium; Reproductive System; developing spermatheca; hypodermis; Nervous System; ventral nerve cord; head neurons
• Primary Identifier: Expr5388
• Remark: Also expressed in (comments from author) : No comments. Strain: BC11215
• Reporter Gene: [C30F12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTCTTGGTTCCGAATCATC] 3' and primer B 5' [GAATTGGGGAGAGGATTTCA] 3'.

9 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Epidermal layer.	hypodermis	epidermis	WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00016261	C30F12.2	C30F12.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023