WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; head mesodermal cell; seam cells; unidentified cells in head; Larval Expression: anal depressor muscle; head mesodermal cell; seam cells; unidentified cells in head; Primary Identifier  Expr5353
Remark  Also expressed in (comments from author) : No comments. Strain: BC14919 Reporter Gene  [dpf-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACCTGGTCTCGACACATTTT] 3' and primer B 5' [ATCATTCTCCATTTTTCGAAACTC] 3'.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001055 dpf-2 C27C12.7 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023