Picture: Fig. 10, A and B. |
|
Expr4821
|
The hex-1 promoter was particularly active in coelomocytes as well as in neurons of the pharyngeal region and nerve cord, as compared with the head and tail pattern observed in strain BC14144 (see Expr6695). Expressed throughout the life-cycle. |
|
Reporter gene fusion type not specified. |
|
Expr4796
|
cnx-1 was expressed ubiquitously in every blastomere of the embryos up to the gastrulation stage but expression became gradually restricted to the head and tail regions at the comma stage during embryogenesis. During post-embryonic development, cnx-1 was expressed prominently in the H-shaped excretory cell, in the neurons of head and tail, in the dorsal and ventral nerve cords, and in the spermatheca. cnx-1 expression was also observed in the spicules of the male tail. The two head neurons expressing cnx-1 are ASK and ADL, and two tail neurons are PHA and PHB. Therefore, cnx-1 is expressed in head neurons including ASK and ASI chemosensory neurons and tail neurons including PHA and PHB. |
|
|
|
Expr4779
|
The fkb-6 transcript was temporally expressed in all stages from embryo to adult with predominant spatial expression being noted in the adult dorsal and ventral nerve cords. In addition, weaker spatial expression was noted in the pharynx, hypodermis, body wall muscle cells and some somatic and gut cells. |
|
|
|
Expr4767
|
Young embryos did not present a GFP signal, but expression was observed in late embryogenesis and at all stages of postnatal development: eggs, L1, L2, L3, L4, and adults. Adult animals showed stronger expression than did larval stages and eggs; this was also proved by RT-polymerase chain reaction (RT-PCR), suggesting potential developmental dynamics in atx-3 function. Both transgenic strains had a generalized expression pattern, with a strong signal in the spermatheca and vulval muscle . High fluorescence was observed in neuronal dorsal and ventral cord and neurons of the head and tail. Expression was also observed in the hypoderm, body muscles, and coelomocytes. |
|
Picture: Fig. 5, Fig 6. |
|
Expr4956
|
NAB-1::GFP expression is restricted to epithelia and neurons. The earliest expression was observed in the hypodermis of 2-fold-stage early embryos. Immediately prior to hatching, this expression became restricted to the epithelial excretory canal and the nervous system, including the central nervous system and the motoneurons (dorsal and ventral nerve cords. In L3 and L4 larvae, NAB-1::GFP also localized transiently at the membranes of the developing vulva epithelia. Also expressed in distal tip cell (pers. comm. from Wesley Hung 11-17-07.) |
NAB-1::GFP puncta partially co-localized with the synaptic-vesicle protein SNT-1 and the active-zone protein UNC-10, suggesting that NAB-1 is present in presynaptic regions that are associated with vesicle pools and active zones. Similar to NAB-1, SAD-1 also showed co-localization with SNT-1. NAB-1::GFP and SAD-1 also showed partial co-localization, where each NAB-1::GFP punctum was associated with SAD-1 staining. |
Picture: Figure 4. |
|
Expr4900
|
UNC-69::GFP expression was first detectable in embryos. In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in neurons of the anterior, lateral, ventral and retro-vesicular ganglia in the head, and in neurons of the preanal, dorso-rectal and lumbar ganglia in the tail. The fusion protein was also present in the ventral nerve cord (VNC), in the dorsal nerve cord (DNC), in the dorsal and ventral sublateral nerve cords, and in commissural axons. The reporter was expressed in the neurons named CAN, HSN, ALM, PLM, AVM, PVM, BDU, and SDQR, as evidenced by its localization to the cell bodies of these neurons. Expression of unc-69 in these latter cells was confirmed using an unc-69::LacZ::NLS fusion. |
In immature neurons, UNC-69::GFP expressed in the processes and growth cones of developing neurites. In older larvae and adults, UNC-69::GFP was expressed in the cell bodies of neurons. |
|
|
Expr4346
|
The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit. |
The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. |
|
|
Expr4347
|
The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. No specific staining was found in animals that did not express any tagged nAChR subunit. |
The antibodies specifically stained punctate sites along the nerve ring and in the ventral and dorsal nerve cords, where NMJs are located. |
|
|
Expr4348
|
ODR-2::HA was observed on cell surfaces in the nervous system. The protein was found on the cell bodies of many neurons in the head and tail, on many neuronal processes running along the major (dorsal and ventral) nerve cords, and on the surface of numerous sublateral nerve cords and circumferential commissures. |
ODR-2 appeared to be evenly distributed on the surface of neuronal processes, i.e. not in a clustered fashion, even though varicosities along neuronal processes were clearly visible. |
|
|
Expr4266
|
Reporter genes that begin at -3190, -2021, -1248, and -517 bp upstream of the ATG of this alternate first exon 1 were expressed in body wall muscle cells, neurons in the head, nerve ring, ventral and dorsal nerve cords, neurons, and some epidermal cells in the tail. Weaker expression was also observed in pharyngeal muscles. The expression from promoter 2 started in the embryos at the 1.5-fold stage and was continuous throughout development. Expression from this internal promoter element is observed in vulval cells at the L4 stage and in adult hermaphrodites, including the uterine vulval cells uv1, 2, 3, and surrounding epithelium. |
|
Strain: BC10524 |
[C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'. |
Expr5296
|
Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; |
|
Also expressed in (comments from author) : unidentified cells in head and near vulva. Strain: BC10721 |
[C17H12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGGTCCCTTCTGAATACAAC] 3' and primer B 5' [TTAAAGCATCGATTGTCGTTTG] 3'. |
Expr5297
|
Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ; |
|
Strain: BC10218 |
[C13F10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTGGAAAAGTTAACAAAA] 3' and primer B 5' [GATCCATGAAACTGTTGAGTCTG] 3'. |
Expr5257
|
Adult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; |
|
Strain: BC10711 |
[C13F10.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGCTGGAAAAGTTAACAAAA] 3' and primer B 5' [GATCCATGAAACTGTTGAGTCTG] 3'. |
Expr5258
|
Adult Expression: Reproductive System; vulval muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; |
|
Strain: BC13281 |
[C09G12.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCGATTTTTCACCAAGTTTGC] 3' and primer B 5' [TGGGCCGAGATGAGGTAG] 3'. |
Expr5223
|
Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in head; unidentified cells in tail ; |
|
Also expressed in (comments from author) : This strain is an UNC. Strain: BC12544 |
[stdh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGTGACCCTATTCAACAAAA] 3' and primer B 5' [TGTCGAAGATTTTAGCAAAATTAG] 3'. |
Expr5185
|
Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; |
|
Also expressed in (comments from author) : No comments. Strain: BC15051 |
[ife-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTACAGCTAATTGCGAAGAATGAA] 3' and primer B 5' [ACGTTTCAGCTTCGATCTCTG] 3'. |
Expr5177
|
Adult Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing vulva; developing spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; |
|
Also expressed in (comments from author) : No comments. Strain: BC11513 |
[pld-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAATTAGTTTTGCATCCTTTTTGC] 3' and primer B 5' [TCTTCGCTCTCGATATTTCTGTC] 3'. |
Expr5154
|
Adult Expression: pharynx; rectal gland cells; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; |
|
Strain: BC13645 |
[C04F12.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCCCGGTTGCCTCTAATAGT] 3' and primer B 5' [GGTGTAGAAACCGGATCTGAAA] 3'. |
Expr5145
|
Adult Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; mechanosensory neurons; neurons along body; tail neurons; |
|
Also expressed in (comments from author) : high intensity GFP, other tissues may be masked Strain: BC12752 |
[C02E11.1a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAGGTCAAATTTTCGTCGATT] 3' and primer B 5' [TAAAGAACCGATGATCTGGAAAA] 3'. |
Expr5110
|
Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; tail neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; |
|
Also expressed in (comments from author) : High intensity GFP.Mosaic population. Strain: BC14155 |
[rab-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTAAGCCAAAGCCAAAGCC] 3' and primer B 5' [TGCTGCCATCTCCTTTTTG] 3'. |
Expr5476
|
Adult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; Reproductive System; distal tip cell; developing gonad; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; unidentified cells in tail ; |
|
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10604 |
[C36A4.9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATAGCCCAAAAAGGCCGAAT] 3' and primer B 5' [GAACGTCCGAGATGATGAGA] 3'. |
Expr5439
|
Adult Expression: intestine; hypodermis; Nervous System; nerve ring; head neurons; Larval Expression: intestine; Nervous System; nerve ring; dorsal nerve cord; head neurons; |
|
Strain: BC10190 |
[C30F8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTTTGCAACGCACTTTTT] 3' and primer B 5' [TGTGAAAATCGGGGGAAAG] 3'. |
Expr5390
|
Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; hypodermis; excretory cell; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; intestine; hypodermis; excretory cell; Nervous System; ventral nerve cord; dorsal nerve cord; unidentified cells in head; unidentified cells in tail ; |
|
Also expressed in (comments from author) : Beautiful intestinal muscle. Strain: BC10720 |
[rpy-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTTTGCAATGATTTTTCAAGTC] 3' and primer B 5' [CGTCGATGATTCGTGATGAG] 3'. |
Expr5313
|
Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; |
|
Strain: BC14584 |
[C33D12.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCCGCAATTTGTTTTCTTGA] 3' and primer B 5' [ATGGTGTCTTTGACATTGAACG] 3'. |
Expr5408
|
Adult Expression: intestine; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; Larval Expression: intestine; body wall muscle; Nervous System; ventral nerve cord; dorsal nerve cord; head neurons; |
|
Strain: BC10419 |
[B0416.5b::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATTCGATGGTTCTTCCACG] 3' and primer B 5' [AGCGCCGATTTTGCTTTT] 3'. |
Expr5071
|
Adult Expression: pharynx; Reproductive System; vulval muscle; spermatheca; body wall muscle; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; neurons along body; tail neurons; unidentified cells; Larval Expression: pharynx; hypodermis; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells; |
|
Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. Strain: BC12796 |
[arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'. |
Expr5055
|
Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons; |
|
Also expressed in (comments from author) : Mosaic population. Strain: BC11512 |
[B0334.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTAAAATTCGGGAGAAACGAAA] 3' and primer B 5' [AATCCCAAAGCTTGATCTTGAA] 3'. |
Expr5052
|
Adult Expression: pharynx; intestine; Reproductive System; vulva other; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; unidentified cells in tail ; Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; |
|
Also expressed in (comments from author) : No comments. Strain: BC15504 |
[ntl-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCTTGCTCGAACCCCATT] 3' and primer B 5' [GTCGTCTGCTAAGATCTGCAATAA] 3'. |
Expr5043
|
Adult Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; rectal gland cells; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons; |
|
Strain: BC12073 |
[xnp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGAAAGAAACTGTGCAGGAA] 3' and primer B 5' [CACCAACTCTCATTAGTTGACAGA] 3'. |
Expr5019
|
Adult Expression: body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; |
|