WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; uterus; vulva other; spermatheca uterine valve; Larval Expression: pharynx; pharyngeal-intestinal valve; Reproductive System; developing vulva; developing uterus; excretory cell; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr6569
Remark  Strain: BC14634 Reporter Gene  [hum-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTAAGCTAACGAATCTTAGAGCG] 3' and primer B 5' [ACTACGAATGGAAATGGGAAAAT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine. pharyngeal-intestinal valve cardia WBbt:0005767
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad. spermathecal-uterine junction sp-ut valve WBbt:0006756
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002038 hum-5 T02C12.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023