WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Reproductive System; vulva other; body wall muscle; head mesodermal cell; hypodermis; seam cells; unidentified cells in tail ; Larval Expression: pharynx; rectal gland cells; body wall muscle; head mesodermal cell; hypodermis; seam cells; Primary Identifier  Expr7162
Remark  Also expressed in (comments from author) : unidentifed cell in tail Strain: BC12892 Reporter Gene  [ZC373.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAAATGTGGGCGAAGGT] 3' and primer B 5' [GTTCGCAAATTAATCTCAAACAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
posterior region, from rectum to the end tail   WBbt:0005741
  rectal gland cell   WBbt:0005799
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013870 ZC373.5 ZC373.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023