WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: intestine; vulval muscle; spermatheca; gonad sheath cells; seam cells; Larval Expression: intestine; developing vulva; developing uterus; gonad sheath cells; seam cells; Primary Identifier  Expr7240
Remark  Strain: BC14626 Reporter Gene  [ZK652.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAATTCAGGTTGCTTTCCC] 3' and primer B 5' [TGAAAATCTCTCGCATAAAATCAA] 3'.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
female genital. vulva   WBbt:0006748
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00044324 ufm-1 ZK652.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023