WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; pharyngeal neurons; tail neurons; Larval Expression: pharynx; Nervous System; nerve ring; ventral nerve cord; head neurons; amphids; pharyngeal neurons; tail neurons; Primary Identifier  Expr5410
Remark  Also expressed in (comments from author) : AFD + AWB amphid neurons (Thomas Lab 2005) Strain: BC12177 Reporter Gene  [C33G8.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTTCACATATGAAACATCCATGA] 3' and primer B 5' [CTCGCAGTCCGAGATTCTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

8 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016363 srab-4 C33G8.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023