WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; intestine; Reproductive System; uterine-seam cell; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Larval Expression: pharynx; intestine; Reproductive System; gonad sheath cells; Nervous System; head neurons; amphids; tail neurons; phasmids; Primary Identifier  Expr5383
Remark  Strain: DM12665 Reporter Gene  [C30F12.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATCCCACGTGTGCAATGTT] 3' and primer B 5' [ATCGATCTTGAAATTTTGTGGTTT] 3'.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of phasmid sensillum phasmid neuron   WBbt:0006753
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC. uterine seam cell utse WBbt:0006789
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016260 rege-1 C30F12.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023