WormMine: ExpressionPattern Expr6867

• Pattern: Adult Expression: intestine; rectal gland cells; Reproductive System; vulval muscle; body wall muscle; Nervous System; ventral nerve cord; lateral nerve cords; unidentified cells in head; unidentified cells in tail ; Larval Expression: intestine; rectal gland cells; body wall muscle; Nervous System; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6867
• Remark: Strain: BC11520
• Reporter Gene: [Y102A11A.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCAAGCGTCTGTAAATGTG] 3' and primer B 5' [TTGGCGATTATGCCTTTTTC] 3'.

10 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
posterior region, from rectum to the end	tail		WBbt:0005741
	rectal gland cell		WBbt:0005799
anterior-most body region containing the pharynx.	head		WBbt:0005739
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA.	lateral nerve cord		WBbt:0006769
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00022412	Y102A11A.2	Y102A11A.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023