WormMine: ExpressionPattern Expr6291

• Pattern: Adult Expression: pharynx; intestine; Reproductive System; uterine muscle; vulval muscle; spermatheca; body wall muscle; seam cells; excretory gland cells; Nervous System; ventral nerve cord; head neurons; tail neurons; Larval Expression: pharynx; intestine; body wall muscle; seam cells; excretory gland cells; Nervous System; ventral nerve cord; head neurons; tail neurons
• Primary Identifier: Expr6291
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15083
• Reporter Gene: [H37N21.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGCCACATTACCAATAGTTTAGG] 3' and primer B 5' [CACCGGAACTGACGATTG] 3'.

13 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct.	excretory gland cell	exc gl	WBbt:0005776
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail	seam cell	lateral hypodermis	WBbt:0005753
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00010427	hpo-11	H37N21.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023