WormMine: Gene WBGene00004051

• WormBase Gene ID: WBGene00004051
• Gene Name: parg-1
• Sequence Name: F20C5.1
• Brief Description: parg-1 (formerly known as pme-3) encodes a poly(ADP-ribose) glycohydrolase (PARG) orthologous to human PARG (OMIM:603501) and paralogous to PARG-2; PARG-1 exhibits poly(ADP-ribose) glycohydrolase activity in vitro, and is required in vivo for normal resistance to ionizing radiation; PARG-1 is primarily expressed in the nuclei of nerve cells in the head and tail, as well as in the nerve cord and motor neurons; PARG-1 is also expressed in embryos; neuronal expression of PARG-1 may reflect a requirement for PARG in preventing neurodegeneration like that seen in Drosophila.
• Organism: Caenorhabditis elegans
• Automated Description: Enables poly(ADP-ribose) glycohydrolase activity. Involved in nucleotide-sugar metabolic process and response to gamma radiation. Located in neuron projection and nucleus. Expressed in tail neurons and ventral cord neurons. Is an ortholog of human BPHL (biphenyl hydrolase like) and PARG (poly(ADP-ribose) glycohydrolase).
• Biotype: SO:0001217
• Genetic Position: IV :3.95897 ±0.000944
• Length (nt): 6425

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00004051

Genomics

9 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F20C5.1f.1	F20C5.1f.1	2622	IV: 8746252-8752676
Transcript:F20C5.1h.1	F20C5.1h.1	2613	IV: 8746252-8752676
Transcript:F20C5.1b.1	F20C5.1b.1	2568	IV: 8746252-8752676
Transcript:F20C5.1i.1	F20C5.1i.1	2628	IV: 8746252-8752676
Transcript:F20C5.1a.1	F20C5.1a.1	2616	IV: 8746254-8752675
Transcript:F20C5.1g.1	F20C5.1g.1	2555	IV: 8746255-8752675
Transcript:F20C5.1d.1	F20C5.1d.1	2118	IV: 8746292-8751697
Transcript:F20C5.1c.1	F20C5.1c.1	1878	IV: 8747401-8752443
Transcript:F20C5.1e.1	F20C5.1e.1	1815	IV: 8747820-8752443

Other

9 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F20C5.1a	F20C5.1a	2346	IV: 8746292-8746336
CDS:F20C5.1g	F20C5.1g	2286	IV: 8746292-8746336
CDS:F20C5.1d	F20C5.1d	2118	IV: 8746292-8746336
CDS:F20C5.1c	F20C5.1c	1878	IV: 8747401-8747418
CDS:F20C5.1e	F20C5.1e	1815	IV: 8747820-8747936
CDS:F20C5.1b	F20C5.1b	2295	IV: 8746292-8746336
CDS:F20C5.1f	F20C5.1f	2349	IV: 8746292-8746336
CDS:F20C5.1h	F20C5.1h	2340	IV: 8746292-8746336
CDS:F20C5.1i	F20C5.1i	2355	IV: 8746292-8746336

7 RNAi Result

• WBRNAi00001869
• WBRNAi00045086
• WBRNAi00007757
• WBRNAi00013604
• WBRNAi00077896
• WBRNAi00065515
• WBRNAi00065516

98 Allele

• gk964278
• gk964500
• gk962765
• gk962666
• gk963722
• gk963417
• gk963418
• otn11295
• h7619
• WBVar01453448
• gk958987
• WBVar02041955
• gk207761
• gk207762
• gk207759
• gk207760
• gk207757
• gk207758
• gk509056
• gk843478
• gk207767
• WBVar02090066
• gk900568
• gk207768
• gk932627
• gk207765
• gk562456
• gk207766
• gk207763
• gk440303

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00004051
• Start: 8746252
• End: 8752676
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8752677..8752698
• Length (nt): 22
• Chromosome Location: IV: 8752677-8752698
• Organism: Caenorhabditis elegans

125 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Transcripts that showed significantly increased expression in day 1 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-1-adult_vs_L4_upregulated_fem-3(q20)
	Transcripts that showed significantly increased expression in day 3 adult hermaphrodite comparing to in L4 larva fem-3(q20) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_upregulated_fem-3(q20)
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Strictly maternal class (SM): genes that are the subset of maternal genes that are not also classified as embryonic.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_SM
	Transcripts that showed significantly increased expression in animals exposed to 400uM tamoxifen from L1 to L4 larva stage.	DEseq2, fold change > 2	WBPaper00064505:tamoxifen_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Transcripts that showed significantly altered expression at URX, AQR, and PQR neurons in camt-1(ok515) animals comparing to in wild type AX1888-1 strain.	RNA-seq data were mapped using PRAGUI - a Python 3-based pipeline for RNA-seq data analysis.	WBPaper00061902:camt-1(ok515)_regulated_URX-AQR-PQR
	Transcripts that showed significantly increased expression in hda-1(RNAi) embryos comparing to control animals.	DESeq2, fold change > 2, FDR < 0.05.	WBPaper00067044:hda-1(RNAi)_upregulated
Fungi infection: Haptoglossa zoospora.	Transcripts that showed significantly altered expression after L4 N2 animals were exposed to omycete Haptoglossa zoospora for 6 hours.	Kalisto abundance files were converted and analysed using Sleuth in a R pipeline. Standard Sleuth protocols were used to calculate differential expression. P value < 0.01 and FDR < 0.01.	WBPaper00062354:H.zoospora_6h_regulated
	Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
Bacteria: B.thuringiensis	Transcripts in elt-2(RNAi) animals that were significantly differentially expressed at least for one time point and one pathogenic strain Bt247 and Bt679 compared to the non pathogenic strain Bt407.	Cuffdiff	WBPaper00060358:B.thuringiensis_pathogen_regulated_elt-2(RNAi)
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed decreased expression in hlh-11(ko1) knockout strain comparing to in wild type background.	DESeq2, FDR < 0.05	WBPaper00060683:hlh-11(ko1)_downregulated
Bacteria infection: Enterococcus faecalis OG1RF. Exposure for 16 hours.	Transcripts that showed significantly decreased expression in hpx-2(dg047) after animals were exposed to E. faecalis OG1RF for 16 hours comparing to exposure to E. Coli OP50.	Cuffcompare and Cuffdiff	WBPaper00056090:E.faecalis_downregulated_hpx-2(dg047)
	Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014.	N.A.	WBPaper00026929:sir-2.1_overexpression_regulated
	Germline-intrinsic transcripts.	Comparisons were made between genotypes by subtracting the mean log value of one ratio from another, and the significance of the difference was evaluated using Student t-test for two populations. For the fem-3(gf) versus fem-1(lf) direct comparison, authors performed the same analysis, except they used a Students t-test for one population. Author chose a combination of a twofold difference with a t value exceeding 99% confidence (P < 0.01), because these criteria allowed the inclusion of essentially all genes that had previously been identified as germline-enriched in a wt/glp-4 hermaphrodite comparison. Additionally, requiring a twofold difference reduced false positives, as the number of genes with two-fold difference and a P<0.01 only included ~100 genes more than with P < 0.001, and almost all genes showed germline expression by in situ hybridization.	[cgc6390]:intrinsic
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_downregulated
	Genes expressed in N2.	Expressed transcripts were identified on the basis of a Present call in 3 out of 4 N2 experiments as determined by Affymetrix MAS 5.0.	WBPaper00025141:N2_Expressed_Genes
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (FLT) starting at L1 lava stage.	DESeq	WBPaper00053302:alovudine_24h_regulated
	Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C.	N.A.	WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
	Transcripts that showed significantly decreased expression in pals-22(jy3) comparing to in N2 at L4 larva stage.	Differential expression analysis was performed in RStudio (v1.1.453) using R (v3.50) and Bioconductor (v3.7) packages. As outlined in the RNAseq123 vignette, data was imported, filtered and normalized using edgeR, and linear modeling and differential expression analysis was performed using limma. An FDR cutoff of <0.01 was used to define differentially expressed genes; no fold-change criteria was used.	WBPaper00056034:pals-22(jy3)_downregulated
	Total muscle depleted genes (complete list of non-overlapping genes from the 0hr and 24hr muscle depleted datasets).	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:total_muscle_depleted

11 Expression Patterns

• Primary Identifier: Expr1031951
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr4509
• Pattern: Expressed principally in nerve cells of the head and tail. Expression of PME-3 is also shown along the body of the worm in nerve cord and in motor neurons.
• Subcellular Localization: A careful analysis clearly shows that most of the nuclei from pme-3::gfp worms are intensely fluorescent compared to the rest of the cell body. This suggests that PME-3 is predominantly localized to the nucleus.

• Primary Identifier: Expr5802
• Remark: Also expressed in (comments from author) : No comments. Strain: BC14952
• Reporter Gene: [pme-3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTACCGACGTTTGTTTGC] 3' and primer B 5' [AGTGTCGATGTGTTTTGTGAAAGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; head neurons; Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; head neurons

• Primary Identifier: Chronogram124
• Remark: Original chronogram file: chronogram.1130.xml
• Reporter Gene: [F20C5.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2014732
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr15901
• Subcellular Localization: We found expression of PARG-1 in both the cytosol and the nucleus in WT animals

• Primary Identifier: Expr15902
• Subcellular Localization: Western blot analysis of fractionated extracts detects PARG-1 in all subcellular compartments with enrichment in the nuclear chromatin-bound fraction.

• Primary Identifier: Expr15903
• Subcellular Localization: Immunofluorescence analyses showed that PARG-1::GFP is first detected in premeiotic and leptotene/zygotene nuclei and then became progressively enriched along chromosomes throughout pachytene. In late pachytene, PARG-1::GFP showed retraction toward the short arm of the bivalent (a chromosomal subdomain formed in response to CO formation) which was particularly evident at diplotene. In nuclei at the diakinesis stage, PARG-1::GFP was detectable mostly in the nucleoplasm. Co-staining with axial proteins HTP-1/ HTP-3 and the central SC component SYP-138,39,48 revealed recruitment of PARG-1::GFP onto synapsed chromosomes and confirmed its retraction to the short arm of the bivalent in late pachytene cells, which also harbors the chiasma and the central elements of the SC49,50. Overlapping localization of PARG-1::GFP with both the CO-promoting factor COSA-1 and SYP-1 further proved recruitment of PARG-1 to this chromosomal subdomain, similar to SC central elements48,51-54. Immunofluorescence analyses showed that PARG-1::GFP is first detected in premeiotic and leptotene/zygotene nuclei and then became progressively enriched along chromosomes throughout pachytene. In late pachytene, PARG-1::GFP showed retraction toward the short arm of the bivalent (a chromosomal subdomain formed in response to CO formation) which was particularly evident at diplotene. In nuclei at the diakinesis stage, PARG-1::GFP was detectable mostly in the nucleoplasm. Co-staining with axial proteins HTP-1/ HTP-3 and the central SC component SYP-138,39,48 revealed recruitment of PARG-1::GFP onto synapsed chromosomes and confirmed its retraction to the short arm of the bivalent in late pachytene cells, which also harbors the chiasma and the central elements of the SC49,50.

• Primary Identifier: Expr2032966
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149035
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1015379
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

21 GO Annotation

4 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00004051
• Start: 8746252
• End: 8752676
• Strand: 1

21 Ontology Annotations

1 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Proteins interacting with PARG-1-GFP.	The search was performed withfull trypsin specificity and a maximum of 2 missed cleavages at aprotein and peptide spectrum match false discovery rate of 1%.	WBPaper00063924:PARG-1_interacting

1 Sequence

• Length: 6425

1 Sequence Ontology Term

• Name: gene

2 Strains

• WBStrain00035527
• WBStrain00003311

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8745692..8746251
• Length (nt): 560
• Chromosome Location: IV: 8745692-8746251
• Organism: Caenorhabditis elegans