WormMine

WS297

Intermine data mining platform for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00005093 Gene Name  srd-15
Sequence Name  ? C04E6.10 Organism  Caenorhabditis elegans
Automated Description  Predicted to be located in membrane. Expressed in amphid neurons. Biotype  SO:0001217
Genetic Position  V :-0.776262 ±0.002483 Length (nt)  ? 1436
Quick Links:
 
Quick Links:
 

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Synonyms

Value
WBGene00005093

Genomics

1 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:C04E6.10.1 C04E6.10.1 1113   V: 5904917-5906352
 

Other

1 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:C04E6.10 C04E6.10 1014   V: 5905015-5905114

2 RNAi Result

WormBase ID
WBRNAi00039603
WBRNAi00010116

29 Allele

Public Name
gk963301
gk963591
gk963553
gk963042
gk963041
gk964259
gk964351
gk963850
gk964248
gk964249
gk629081
gk516444
gk376940
gk480639
gk645379
gk236165
WBVar00209926
gk481110
WBVar00209925
gk905648
WBVar00209924
gk236164
WBVar01808186
WBVar01808187
WBVar00586400
gk394438
gk591817
gk850176
gk413745

1 Chromosome

WormBase ID Organism Length (nt)
V Caenorhabditis elegans 20924180  

1 Chromosome Location


Feature . Primary Identifier
Start End Strand
WBGene00005093 5904917 5906352 -1

3 Data Sets

Name URL
WormBaseAcedbConverter  
GO Annotation data set  
C. elegans genomic annotations (GFF3 Gene)  

1 Downstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_5904844..5904916   73 V: 5904844-5904916 Caenorhabditis elegans

33 Expression Clusters

Regulated By Treatment Description Algorithm Primary Identifier
  Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells. DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction. WBPaper00060811:L1_vs_adult_upregulated_neural
  Transcripts of coding genes that showed significantly decreased expression in muscle. DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed. WBPaper00062325:muscle_depleted_coding-RNA
adult vs dauer larva Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C. N.A. WBPaper00050488:adult_vs_dauer_regulated_N2_20C
  mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis. Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05. WBPaper00045420:fertilization_downregulated_transcript
  Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology. DESEQ2, fold change > 2 and FDR < 0.01. WBPaper00062103:neuron_enriched
  Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_age_regulated_developing
  Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade). For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR). WBPaper00040858:eQTL_regulated_aging
  Genes with expression level regulated by genotype (N2 vs CB4856) at Late reproduction stage (96 hours at 24 centigrade). Authors permuted transcript values and used a genome-wide threshold of log10 P-value = 2, which resembles a false discovery rate (FDR) of 0.0118. WBPaper00040858:eQTL_regulated_reproductive
  Genes found to be regulated by low-copy overexpression of sir-2.1 with p < 0.014. N.A. WBPaper00026929:sir-2.1_overexpression_regulated
  Transcripts that showed differential expression in dauer mir-34(gk437) vs dauer mir-34(OverExpression) animals at 20C. N.A. WBPaper00050488:mir-34(gk437)_vs_mir-34(OverExpression)_regulated_dauer_20C
  Genes enriched in AMsh glia. Two different statistical methods were used for differential gene expression analysis, DESeq and voom. For DEseq analysis, DESeq2 was applied to normalize count matrix and to perform differential gene expression on the counts using negative binomial distribution; for voom analysis, edgeR was applied to normalize count matrix, and voom was applied for gene differentiation analysis. Significant genes from both analyses were combined. To identify transcripts enriched in AMsh glia compared to other cells (control AMsh versus control non-AMsh), authors used a fold change of 3.5 and an adjusted p value threshold of <0.05. WBPaper00049489:AMsh-glia_enriched
  Transcripts that showed altered expression in cat-2(RNAi) animals comparing to control animals injected with empty vector. p-value <= 0.05 WBPaper00066902:cat-2(RNAi)_regulated
  Embryonic Pan-neural Enriched Genes. A two-class unpaired analysis of the data was performed to identify genes that differ by >= 1.5-fold from the reference at a FDR of <1% for the larval pan-neural, embryonic pan-neural, and larval A-class motor neuron datasets. WBPaper00030839:Embryo_Pan_Neuronal
  Down-regulated genes (fold change > 1.5) in two CoQ-deficient clk-1 mutant strains (e2519, qm30) compared to wild types N2. Fold-changes of intensities were calculated from the arithmetic mean of gene expression values between experimental and corresponding control group. Fold change >= 1.5 was used as cut-off. WBPaper00045774:clk-1_downregulated
Bacteria infection: Enterococcus faecalis Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:E.faecalis_24hr_upregulated_RNAseq
  Genome-wide analysis of developmental and sex-regulated gene expression profile. self-organizing map cgc4489_group_17
Bacteria infection: Photorhabdus luminescens Genes with decreased expression after 24 hours of infection by P.lumniescens Fold changes shown are pathogen vs OP50. For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated. WBPaper00038438:P.lumniescens_24hr_downregulated_RNAseq
  Transcripts that showed significantly increased expression in FACS sorted neuron cells (labelled by pan-neuronal GFP) from edIs6[unc-119::GFP + rol-6(su1006)]; thoc-5(wy822) comparing to in edIs6. DESeq2, log2 fold change > 2, adjusted p-value < 0.005. WBPaper00055103:thoc-5(wy822)_upregulated
  Genes predicted to be upregulated more than 2.0 fold in (AFD+AWB) datasets as compared to unsorted whole embryonic cells dataset. Genes predicted to be regulated more than 2.0 fold. WBPaper00024671:AFD_AWB_vs_unsorted_upregulated
  Coexpression clique No. 282, srj-21-srh-32, on the genome-wide coexpression clique map for the nematode GPL200 platform. All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform. WBPaper00061527:srj-21-srh-32
  Transcripts that showed significantly decreased expression in hlh-26(ok1453) animals exposed to E. faecium for 8 hours, comparing to N2 animals exposed to E. faecium for 8 hours. Fold change > 2. WBPaper00062585:hlh-26(ok1453)_downregulated_E.faecium
Bacteria infection: Stenotrophomonas maltophilia Transcripts that showed significantly decreased expression after fed with S. maltophilia strains JCMS or K279a for 24 hours at 25C, comparing to control animals fed with OP50. Benjamini-Hochberg fold change >= 1.5, p-value < 0.05. WBPaper00055137:S.maltophilia_downregulated
  Enriched in intestinal (adult).   WBPaper00029359_1280
  Enriched in intestinal (adult).   WBPaper00029359_1444
  Enriched in intestinal (adult).   WBPaper00029359_1504
  Enriched in intestinal (adult).   WBPaper00029359_1604
  Enriched in intestinal (adult), body wall muscle (adult), pharynx).   WBPaper00029359_1578
  Enriched in vulval muscle (adult), body wall muscle (adult).   WBPaper00029359_1183
control(maintained under normal lab light (mostly dark, in incubators).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at just prior to the second UVC dose (24h). Genes differentially expressed in control vsafter UVC exposure without EtBr treatment, at the -25h timepoint (just prior to the second UVC dose (24h)) Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first. WBPaper00041939:control_vs_UVC-exposed_24h
  Co-expression group from Chronogram study.   WBPaper00029359_1364

6 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
Also expressed in (comments from author) : Expression in 2 non-DiI stained head neuron pairs between anterior and posterior pharyngeal bulbs, sending dendrites to tip of nose (Hober Lab apr 2005). Strain: BC15142 [srd-15::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCTGTCTTTTTCTATCGACGAGC] 3' and primer B 5' [TCTTGTGCGATTCTGACAAATTA] 3'. Expr5143 Adult Expression: pharynx; intestine; Reproductive System; spermatheca uterine valve; Nervous System; head neurons; tail neurons; phasmids; Larval Expression: intestine; Reproductive System; Nervous System; head neurons; tail neurons; phasmids; unidentified cells in body ;  
    Expr14033 ADF, ASI (dim), ASH (dim), gut, pharynx (dim), muscle (dim)  
Original chronogram file: chronogram.1286.xml [C04E6.10:gfp] transcriptional fusion. Chronogram260    
    Expr2016224 Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).  
    Expr1012264 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  
    Expr1143704 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015  

2 GO Annotation

Annotation Extension Qualifier
  located_in
  located_in

0 Homologues

1 Locations


Feature . Primary Identifier
Start End Strand
WBGene00005093 5904917 5906352 -1

2 Ontology Annotations

Annotation Extension Qualifier
  located_in
  located_in

0 Regulates Expr Cluster

1 Sequence

Length
1436

1 Sequence Ontology Term

Identifier Name Description
gene  

2 Strains

WormBase ID
WBStrain00062419
WBStrain00003379

1 Upstream Intergenic Region

WormBase ID Name Sequence Name Length (nt) Chromosome Location Organism
intergenic_region_chrV_5906353..5907389   1037 V: 5906353-5907389 Caenorhabditis elegans