WormMine: Gene WBGene00001834

• WormBase Gene ID: WBGene00001834
• Gene Name: hda-1
• Sequence Name: C53A5.3
• Brief Description: The hda-1 gene encodes a histone deacetylase 1, similar to histone deacetylases RPD3 from yeast and fly; maternal and zygotic expression of hda-1 is required for embryonic viability, and zygotic expression of hda-1 is also required for gonadogenesis and vulval development.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity and histone deacetylase activity. Contributes to transcription corepressor activity. Involved in several processes, including developmental process involved in reproduction; negative regulation of signal transduction; and regulation of transcription by RNA polymerase II. Acts upstream of or within chromatin organization; determination of adult lifespan; and mitochondrial unfolded protein response. Located in cytoplasm and germ cell nucleus. Part of NuRD complex. Expressed in anchor cell; germ line; nervous system; tail; and vulva. Human ortholog(s) of this gene implicated in several diseases, including autoimmune disease (multiple); gastrointestinal system cancer (multiple); and prostate disease (multiple). Is an ortholog of human HDAC1 (histone deacetylase 1) and HDAC2 (histone deacetylase 2).
• Biotype: SO:0001217
• Genetic Position: V :6.43888 ±0.006431
• Length (nt): 2023

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001834

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C53A5.3.1	C53A5.3.1	1839	V: 14525389-14527411

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C53A5.3	C53A5.3	1386	V: 14525408-14525581

74 RNAi Result

• WBRNAi00078291
• WBRNAi00106573
• WBRNAi00113276
• WBRNAi00067004
• WBRNAi00067088
• WBRNAi00067107
• WBRNAi00067121
• WBRNAi00067135
• WBRNAi00067212
• WBRNAi00067290
• WBRNAi00110648
• WBRNAi00030096
• WBRNAi00110645
• WBRNAi00062797
• WBRNAi00024317
• WBRNAi00099785
• WBRNAi00100381
• WBRNAi00063054
• WBRNAi00094010
• WBRNAi00082190
• WBRNAi00082119
• WBRNAi00082122
• WBRNAi00063028
• WBRNAi00092462
• WBRNAi00069934
• WBRNAi00092463
• WBRNAi00082189
• WBRNAi00082117
• WBRNAi00115435
• WBRNAi00100755

34 Allele

• gk963271
• gk962657
• gk963706
• gk962658
• gk963301
• gk964458
• gk964459
• gk963796
• WBVar02062329
• ok1595
• gk553953
• gk668533
• gk840280
• gk660107
• cw2
• gk253866
• gk253865
• gk253864
• gk253863
• gk590137
• gk576832
• gk711363
• gk808297
• gk559764
• gk419873
• WBVar01872117
• gk672092
• gk875367
• tm1202
• gk865599

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001834
• Start: 14525389
• End: 14527411
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_14527412..14531112
• Length (nt): 3701
• Chromosome Location: V: 14527412-14531112
• Organism: Caenorhabditis elegans

131 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
Bacteria diet: Escherichia coli HB101. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria E. coli HB101 for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:HB101_downregulated
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Genes down regulated by mir-243(n4759).	RNAs that changed at least 2-fold with a probability of p > 0.05 in three biological replicates were considered differentially regulated between wild-type and mir-243.	WBPaper00036130:mir-243_down_regulated
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated

10 Expression Patterns

• Primary Identifier: Expr1031079
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5576
• Remark: Also expressed in (comments from author) : unidentified cells around anal pore Strain: BC13706
• Reporter Gene: [hda-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGAAGAAGTGGATGGTGAGTT] 3' and primer B 5' [GGCCGTTTGAGTTGATGTTT] 3'.
• Pattern: Adult Expression: intestine; hypodermis; seam cells; excretory cell; unidentified cells in tail ; Larval Expression: intestine; hypodermis; seam cells; excretory cell; unidentified cells in tail

• Primary Identifier: Expr11136
• Remark: Expression of gfp in sEx13706 animals is directed by a 2.8 kb hda-1 regulatory region that includes the open reading frames and potential cis-regulatory elements(enhancers) of two other hda-1 upstream genes (ril-1 and C53A5.2). The other hda-1::gfp transgenic strain (bhEx72), generated in this study, contains a much smaller 5'upstream region of hda-1 (approximately 1.0 kb, pGLC44) and excludes the two genes mentioned above. The analysis of GFP fluorescence in sEx13706 and bhEx72 animals revealed a similar pattern, although the fluorescence in sEx13706 was much brighter.
• Pattern: hda-1 is broadly expressed throughout development. The earliest expression was detected in gastrulating embryos. The larvae exhibited GFP expression in several neuronal and epidermal cells, primarily in the anterior ganglion and ventral hypodermal regions. Expression persisted in many cells in later larval and adult stages (data not shown). In the vulva, hda-1::gfp expression was first detected in the progeny of P(5-7).p in mid-L3 animals. At this stage, GFP fluorescence was absent in other VPC lineages (P3.p, P4.p and P8.p) (data not shown). By the L4 stage, almost all vulval cell types were observed fluorescing, with presumptive vulA, vulB1, vulB2, and vulD cells being the brightest. GFP fluorescence in vulval cells was mostly absent beyond the late-L4 stage, suggesting that hda-1 may not be needed in vulval cells at later stages of development. The broad expression of hda-1 is in consistent with the involvement of the gene in multiple developmental processes. This multifaceted role for hda-1in C. elegans appears to be conserved in C. briggsae, because Cbr-hda-1::gfp is expressed in a similar manner. hda-1::gfp expression was also observed in the AC in L3 animals that persisted until the early L4 stage (data not shown). No expression was observed in pi cells or their progeny at any developmental stage.

• Primary Identifier: Expr2918
• Pattern: In the wild-type C. elegans, HDA-1 was found in the germ line, indicating that it is a maternally provided protein. HDA-1 expressed ubiquitously throughout embryonic and postembryonic development except sperm.
• Subcellular Localization: HDA-1 was localized in the nucleus with the exception of the germ line including the oocytes where the signal was also detected in the cytoplasm.

• Primary Identifier: Expr10987
• Subcellular Localization: As previously reported, HDA-1 in wild-type animals is detected in most or all cells of the body, including cells of the nervous system (Dufourcq et al., 2002). The protein is concentrated in nuclei (Dufourcq et al., 2002), but, unlike in the previous report, prominent staining was also detected within neuronal processes.

• Primary Identifier: Expr12648
• Pattern: hda-1 was expressed in most cells, including the AC.

• Primary Identifier: Expr1147026
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2030620
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1014987
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2012384
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

63 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001834
• Start: 14525389
• End: 14527411
• Strand: 1

63 Ontology Annotations

6 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in hda-1[KKRR] in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4747)_upregulated
	Transcripts that showed significantly increased expression in hda-1[KKRR]-smo-1 in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4748)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed more than 3 fold increase of expression by hda-1 feeding RNAi	Students t tests were done on the average of the hda-1 (RNAi) vs control log ratio for each gene. The cutoff for inclusion as an HDA-1-regulated gene was set at 1.8-fold difference, with p < 0.05.	WBPaper00025192:hda-1(RNAi)_upregulated
	Proteins interacting with HDA-1	Proteins either absent in N2 or with more than twofold of the spectra counts in the hda-1::gfp IP compared to those in N2 are shown.	WBPaper00061479:HDA-1_interacting_protein
	Genes that showed more than 3 fold decrease of expression by hda-1 feeding RNAi	Students t tests were done on the average of the hda-1 (RNAi) vs control log ratio for each gene. The cutoff for inclusion as an HDA-1-regulated gene was set at 1.8-fold difference, with p < 0.05.	WBPaper00025192:hda-1(RNAi)_downregulated

1 Sequence

• Length: 2023

1 Sequence Ontology Term