WormMine: Gene WBGene00003008

• WormBase Gene ID: WBGene00003008
• Gene Name: lin-22
• Sequence Name: Y54G2A.1
• Brief Description: lin-22 encodes a basic helix-loop-helix (bHLH)-containing protein that is homologous to the Drosophila hairy/Enhancer of split transcriptional repressors; during postembryonic development, lin-22 activity is required for patterning of midbody epidermal and neuronal lineages.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in anterior/posterior pattern specification; negative regulation of gene expression; and nematode male tail tip morphogenesis. Acts upstream of or within epidermal cell fate specification. Predicted to be located in nucleus. Expressed in seam cell. Human ortholog(s) of this gene implicated in hemangiopericytoma. Is an ortholog of human HES1 (hes family bHLH transcription factor 1).
• Biotype: SO:0001217
• Genetic Position: IV :-6.65585 ±0.044343
• Length (nt): 3567

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003008

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:Y54G2A.1.1	Y54G2A.1.1	1613	IV: 3019738-3023304

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:Y54G2A.1	Y54G2A.1	522	IV: 3019740-3019808

1 RNAi Result

• WBRNAi00057436

74 Allele

• gk963722
• gk962726
• WBVar02020268
• gk671259
• gk720566
• gk412103
• gk397936
• gk634746
• gk700719
• gk526378
• gk748934
• gk818114
• gk810833
• gk833933
• gk638277
• gk490502
• gk392378
• gk916437
• gk775343
• gk698137
• gk882928
• gk459026
• gk678520
• gk519553
• WBVar00186689
• WBVar00186688
• WBVar00186687
• WBVar00186690
• gk945787
• gk945788

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003008
• Start: 3019738
• End: 3023304
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_3023305..3023402
• Length (nt): 98
• Chromosome Location: IV: 3023305-3023402
• Organism: Caenorhabditis elegans

68 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Single-cell RNA-Seq cell group 0_0 expressed in seam.	scVI 0.6.0	WBPaper00065841:0_0
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed significantly increased expression in animal with pgph-2 overepxreesion [pgph-2p-pgph-2; myo-2p-mcherry] in glucose excess condition.	Genes with anadjusted P-value <= 0.05 found by DESeq2 were assigned as differentially expressed.	WBPaper00065926:pgph-2(overepxreesion)_upregulated_glucose
	Transcripts that showed significantly increased expression in oocyte germline cells comparing to in mitosis germline cells.	Log2 Fold change > 2 or <-1, p-value < 0.05.	WBPaper00053599:oocyte_vs_mitosis_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 0hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:germline-precursors_blastula-embryo_expressed
	Transcripts that showed significantly decreased expression in rbr-2(tm3141) comparing to in N2 animals.	Mapped reads were analyzed for transcript assembly and differential expression using Cufflinks 2.1.1 with a filter of twofold difference and FDR correction (P < 0.05).	WBPaper00050080:rbr-2(tm3141)_downregulated
	Transcripts that showed significantly increased expression in hda-2(ok1479) comparing to in N2 animals.	DESeq2 (version 1.28.1), FDR < 0.01, fold change > 2.	WBPaper00062159:hda-2(ok1479)_upregulated
	Transcripts that showed altered expression from P0 to F2 generation animals after N2 parental generation were treated with antimycin, but not in damt-1(gk961032) P0 to F2 animals after the parenal generaton were treated with antimycin.	N.A.	WBPaper00055862:antimycin_damt-1(gk961032)_regulated
Starvation	Transcripts that showed significantly altered expression by starvation with 100 mM salt (NaCl)	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:starvation_regulated_LowSalt
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(-), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(-)_vs_control_day2-adult
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:coelomocytes_L1-larva_expressed
	Transcripts that showed significantly altered expression after 24 hour exposure to nitroguanidine (NQ).	Multivariate permutation tests with random variance model implemented in BRB-Array Tools version 4.5 were performed to infer differentially expressed genes (DEGs). One thousand random permutations were computed per chemical class (i.e., a group of 16 arrays or samples). The confidence level of false discovery rate assessment was set at 80%, and the maximum allowed portion of false-positive genes was 10%.	WBPaper00055899:nitroguanidine_regulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:hypodermis_L1-larva_expressed
	Transcripts that showed significantly increased expression in ints-5(RNAi) comparing to in N2.	DESeq2 and edgeR.	WBPaper00056284:ints-5(RNAi)_upregulated
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated

11 Expression Patterns

• Primary Identifier: Expr7053
• Remark: Also expressed in (comments from author) : Observation in Apr vs Oct 2005: Apr is posted and was low intensity GFP. In Oct, nothing but the proximal tip of the gonad expressed GFP. Strain: BC14240
• Reporter Gene: [Y54G2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGATGGTTTTGGAAAGAGTT] 3' and primer B 5' [ATCGATCAGTTGGGATTTATGG] 3'.
• Pattern: Adult Expression: unidentified cells in body ; Larval Expression: pharynx; developing uterus; hypodermis; Nervous System; head neurons

• Primary Identifier: Expr13574
• Pattern: The full promoter drove lin-22 expression mostly in the seam and hypodermis (hyp7), but also to a much lesser extent in the intestine.

• Primary Identifier: Expr13576
• Pattern: The proximal lin-22 promoter fusion showed rare GFP expression in the seam but more frequent expression in the intestine.

• Primary Identifier: Expr13575
• Pattern: The distal lin-22 promoter drove GFP expression in seam cells and hypodermis, indicating that the deleted region in lin-22(icb38) mutants contained some putative seam cell enhancer activity.

• Primary Identifier: Expr13577
• Pattern: Conserved region 1 (CR1), which contains at least 2 putative GATA binding sites, was required to drive GFP expression in the seam.

• Primary Identifier: Expr13573
• Pattern: In WT, lin-22 expression in the seam is restricted to H0-H2 and V1-V4 cells. After cell division, we found that daughter cells show initially comparable amounts of lin-22 expression, both after the L2 symmetric and the subsequent asymmetric divisions. However, lin-22 expression was maintained specifically in the posterior seam cell-fated daughter cell late after asymmetric divisions.

• Primary Identifier: Expr2013166
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2031398
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1160872
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1200025
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr1014332
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

17 GO Annotation

51 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003008
• Start: 3019738
• End: 3023304
• Strand: 1

17 Ontology Annotations

6 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_upregulated
	Transcripts that showed significantly increased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_upregulated
	Transcripts that showed significantly increased expression in lin-22(ot267) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot267)_upregulated
	Transcripts that showed significantly decreased expression in lin-22(icb38) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(icb38)_downregulated
	Transcripts that showed significantly decreased expression in lin-22(ot267) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot267)_downregulated
	Transcripts that showed significantly decreased expression in lin-22(ot269) comparing to in N2 at L3 larva.	Differences in gene expression were then calculated using the negative binomial test in the DESeq package (FDR = 0.1).	WBPaper00053295:lin-22(ot269)_downregulated

1 Sequence

• Length: 3567

1 Sequence Ontology Term