WormMine: Gene WBGene00006498

• WormBase Gene ID: WBGene00006498
• Gene Name: ten-1
• Sequence Name: R13F6.4
• Brief Description: ten-1 encodes a type II transmembrane protein containing EGF-like repeats that is the C. elegans ortholog of Drosophila Ten-m/Odz and vertebrate teneurins (OMIM:300588); in C. elegans, TEN-1 is required for proper development of the gonadal and pharyngeal basement membranes and for proper axonal placement and hypodermal morphogenesis; ten-1 and phy-1 act in parallel influencing the connection between epidermis and muscle during embryonic development; TEN-1 acts as an epidermal receptor for the BM collagens modified by PHY-1 and secreted by the muscle cells; loss of P4H function in ten-1 null mutants results in embryonic lethality due to arrest during late elongation with morphological defects; ten-1; phy-1 embryos have defects in epidermal development and body wall muscles due to basement membrane defects in arrested embryos; TEN-1 is expressed in the embryo and in multiple tissues during postembryonic development including the somatic gonad founder cells Z1 and Z4 and their descendants, as well as in six marginal cells and the M2 neurons in the pharynx; in the embryo, ten-1 expression overlaps with that of lat-1 in the dorsal left epidermoblasts; as ten-1 and lat-1 also display genetic interactions during embryonic development, the overlapping expression patterns suggest that these two genes have overlapping functions during embryogenesis.
• Organism: Caenorhabditis elegans
• Automated Description: Involved in several processes, including body morphogenesis; inductive cell migration; and system development. Located in nucleus and plasma membrane. Expressed in several structures, including body muscle cell; gonad; hypodermis; interfacial epithelial cell; and neurons. Human ortholog(s) of this gene implicated in cocaine dependence and essential tremor 5. Is an ortholog of human TENM2 (teneurin transmembrane protein 2) and TENM3 (teneurin transmembrane protein 3).
• Biotype: SO:0001217
• Genetic Position: III :-0.935519 ±0.002543
• Length (nt): 26463

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006498

Genomics

6 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:R13F6.4e.1	R13F6.4e.1	8514	III: 6820935-6846783
Transcript:R13F6.4f.1	R13F6.4f.1	8292	III: 6823330-6846783
Transcript:R13F6.4a.2	R13F6.4a.2	8740	III: 6830386-6847397
Transcript:R13F6.4d.1	R13F6.4d.1	8120	III: 6830392-6846783
Transcript:R13F6.4a.1	R13F6.4a.1	8446	III: 6833834-6847283
Transcript:R13F6.4c.1	R13F6.4c.1	2583	III: 6843985-6846615

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:R13F6.4c	R13F6.4c	2583	III: 6843985-6845890
CDS:R13F6.4a	R13F6.4a	7509	III: 6838544-6838706
CDS:R13F6.4d	R13F6.4d	8055	III: 6830457-6830470
CDS:R13F6.4e	R13F6.4e	8514	III: 6820935-6821025
CDS:R13F6.4f	R13F6.4f	8292	III: 6823330-6823501

18 RNAi Result

• WBRNAi00061180
• WBRNAi00061181
• WBRNAi00113317
• WBRNAi00061179
• WBRNAi00061178
• WBRNAi00067928
• WBRNAi00000522
• WBRNAi00045841
• WBRNAi00045842
• WBRNAi00051921
• WBRNAi00061177
• WBRNAi00014056
• WBRNAi00017839
• WBRNAi00005202
• WBRNAi00006766
• WBRNAi00007051
• WBRNAi00092868
• WBRNAi00113088

374 Allele

• gk964518
• gk963887
• gk964032
• gk964033
• gk753038
• gk636758
• gk784647
• WBVar01264755
• WBVar01264763
• gk823314
• gk470789
• gk435013
• gk394898
• WBVar02067592
• gk177289
• WBVar01264749
• WBVar01264753
• WBVar01264752
• WBVar01264751
• WBVar01264757
• WBVar01264756
• WBVar01264759
• WBVar01264764
• WBVar01264766
• WBVar01264765
• WBVar01264760
• WBVar01264768
• WBVar01264767
• WBVar01264769
• WBVar01264775

1 Chromosome

• WormBase ID: III
• Organism: Caenorhabditis elegans
• Length (nt): 13783801

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006498
• Start: 6820935
• End: 6847397
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

153 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts that showed significantly increased expression after animals were treated with 100uM Rapamycin and 50mM Metformin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rapamycin-Metformin_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly increased expression after exposure to 75uM paraquat(PQ) from L1 to day 2 adult stage in skn-1(lax188) animals	fold change > 2	WBPaper00058711:paraquat_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Proteins that showed significantly decreased expression after 1-day-old wild type adults were exposed to cisplatin (300ug per mL) for 6 hours.	The differential expression analysis was performed in R. Differentially expressed proteins were identified by using a two-sided t-test on log-transformed data.	WBPaper00065373:Cisplatin_downregulated_WT
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:glr-1(+)-neurons_L2-larva_expressed
	Genes that were not enriched in either spermatogenic fem-3(q96gf) nor oogenic fog-2(q71) gonads, according to RNAseq analysis.	To identify differentially expressed transcripts, authors used R/Bioconductor package DESeq.	WBPaper00045521:Gender_Neutral
	Transcripts that showed significantly decreased expression in nhl-2(ok818) comparing to in N2 at 25C.	EdgeR, FDR < 0.05, fold change < 0.5.	WBPaper00055971:nhl-2(ok818)_25C_upregulated
	Transcripts that showed significantly increased expression in animals lacking P granules by RNAi experiments targeting pgl-1, pgl-3, glh-1 and glh-4, and unc-119-GFP(+), comparing to in control animals, at 2-day post L4 adult hermaphrodite stage.	DESeq2, Benjamini-Hochberg multiple hypothesis corrected p-value < 0.05 and fold change > 2.	WBPaper00050859:upregulated_P-granule(-)GFP(+)_vs_control_day2-adult
heat-shock hlh-1	Genes enriched in HLH-1 heat shock dataset.	A two-class unpaired analysis was performed to identify genes that are elevated 1.7-fold or greater when compared with the reference for each dataset, at a false discovery rate of 1.8% or less for M0 and 1.2% or less for the M24 datasets.	WBPaper00031003:hlh_1_enriched
	Developmentally modulated gene cluster.	self-organizing map	cgc4386_cluster_6_5
EtBr-exposed(maintained under normal lab light (mostly dark, in incubators) and exposed to EtBr (5ug/mL in agar).) vs UVC-exposed(exposed to 7.5 J/m2 UVC radiation 3 times, 24 h apart (48 h total).) at 3 h after the third UVC dose (51h), which is also 3 h after being placed on food.	Genes differentially expressed under EtBr treatment without UVC exposure vs after UVC exposure but without EtBr treatment at the -3h timepoint (3 h after the third UVC dose (51h), which is also 3 h after being placed on food).	Transcripts were defined as fold-change >1.2, p < 0.05 based on Rosetta Resolver analysis for all pairwise treatment comparisons. The fold-change refers to the second intensity over the first.	WBPaper00041939:EtBr-exposed_vs_UVC-exposed_51h
	Transcripts that showed significantly increased expression in jmjd-3.1p::jmjd-3.1 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:jmjd-3.1(+)_upregulated
	Transcripts that showed significantly increased expression in rgef-1p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:rgef-1p-jmjd-1.2(+)_upregulated
	Transcripts that showed significantly increased expression in sur-5p::jmjd-1.2 comparing to in N2.	DESeq2 Benjamini-Hochberg adjusted p-value < 0.05.	WBPaper00049545:sur-5p-jmjd-1.2(+)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (Young adult all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:CEP-sheath-cells_Day1-adult_expressed

14 Expression Patterns

• Primary Identifier: Expr2035509
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr5904
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15001
• Reporter Gene: [F28F5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGTCAAGTTACGCAATCATTC] 3' and primer B 5' [TGTGACCAGGCATTTTCTATTCT] 3'.
• Pattern: Larval Expression: pharynx; Nervous System; head neurons

• Primary Identifier: Expr6533
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15000
• Reporter Gene: [tag-152::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGGAAAGGGGGTCAAAGAG] 3' and primer B 5' [GACAGAGATAGTCCAGAGACCCAT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr8356
• Remark: Picture: Figure 8.
• Pattern: The long TEN-1 isoform is expressed in the developing and adult pharynx. The GFP::TEN-1 transgene is expressed in the developing pharynx of the early embryo and outlines the adult pharynx. Expression of the kdEx121 is also found in some head neurons.

• Primary Identifier: Expr3278
• Pattern: In the embryo, the upstream promoter (ten-1a) is most active in the descendants of the C and EMS blastomers. During postembryonic development, GFP expression was detected in the pharynx, gut, coelomocytes, posterior body wall muscles, vulva muscles in hermaphrodites, and diagonal muscles in males. The ten-1a promoter is also active in some hypodermal cells including the hyp-11 cell, hypodermal seam cells, and rectal hypodermis. In the somatic gonad, it is active throughout its development starting with z1 and z4 cells in the embryo. During gonad development, it is expressed in the distal tip cells and the linker cell in males, in gonad and spermatheca sheath cells, and the utse cells of the uterus. In males, ten-1a is active in the vas deferens and spicule socket cells. Furthermore, GFP expression in DVB neurons and a few ring interneurons could be detected.

• Primary Identifier: Expr9051
• Remark: Picture: Fig 2A to 2G.
• Pattern: In wild-type embryos, ten-1a::gfp is first expressed in a cluster of cells in the anterior half at approximately 150 minutes after fertilization. These cells are precursors to the hypodermal cells, which are evident at 300 minutes post-fertilization, when the cells intercalate and begin the process of ventral closure, and to pharyngeal and intestinal cells, which are evident beginning at the bean stage. In later stages, strong expression of ten-1a::gfp persists in pharyngeal and intestinal cells, and appears in several head neurons. Examination of L1 larvae and adults allowed us to identify 8 pharyngeal cells that express ten-1a::gfp: the three marginal cells mc1, the three marginal cells mc3, and the neurons M2L and M2R. Adults also express ten-1a::gfp in vulva muscles, the gonad distal tip cells, the intestine, several tail neurons including DVB and some other cells.

• Primary Identifier: Expr3279
• Pattern: In the embryo, the downstream promoter (ten-1b) is most active in the descendants of the ABp cell and in the hypodermis. The dorsal hypodermal cells and the ventral leader cells were most prominently labeled. During postembryonic development, GFP fluorescence was visible in specialized epithelial cells including the arcade cells of the anterior end and the excretory duct. Ten-1b is also active in a subset of neurons including CAN and HSN neurons as well as neurons of the lumbar and retro-vesicular ganglion and some nerve ring interneurons. In males, GFP fluorescence is also visible in R8 and R9 ray neurons.

• Primary Identifier: Expr1032661
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr9052
• Remark: Picture: Fig 2K to 2V.
• Pattern: The expression of the ten-1b reporter differs from that of ten-1a. Initial expression is detected in fewer anterior cells at 150 minutes post-fertilization, and becomes restricted to anterior neuronal cells and posterior hypodermal cells by 300 minutes. By the 1.5-fold stage (~460 minutes post-fertilization), hypodermal cell expression gradually fades away, and strong expression is found only in neurons of the head. This pattern persists to the end of embryogenesis. Post-embryonic expression is found in head and tail neurons and some other cells. DiI showed that the ten-1b::gfp positive neurons are not amphid or phasmid neurons since they did not pick up the dye. Expression of the ten-1b reporter is never observed within the pharynx.

• Primary Identifier: Chronogram935
• Remark: Original chronogram file: chronogram.1981.xml
• Reporter Gene: [R13F6.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1155573
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr10198
• Pattern: ten-1a::gfp promoter reporter shows expression in the same epidermal blastomeres as lat-1::gfp (Expr10197) and additional lineages (ABaraax, MSapx, MSppx; data not shown) except one (Cpaaaa).

• Primary Identifier: Expr1010958
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2017372
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

33 GO Annotation

16 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006498
• Start: 6820935
• End: 6847397
• Strand: 1

33 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 26463

1 Sequence Ontology Term