WormMine: Gene WBGene00006742

• WormBase Gene ID: WBGene00006742
• Gene Name: unc-2
• Sequence Name: T02C5.5
• Brief Description: unc-2 encodes a calcium channel alpha subunit similar to the human P/Q-type calcium channel, CACNA1A; unc-2 is required for desensitization to dopamine, normal movement, normally low sensitivity of whole animals to serotonin, and neuronal migrations; unc-2 interacts with the TGF beta pathway to regulate movement, and maintain normal serotonin levels; unc-2/TGF beta pathway is also required for the stress-induced modulation of tryptophan hydroxylase/tph-1 expression in the serotonergic chemosensory ADF neurons (but not the NSM neurons); UNC-2 is expressed primarily in motor neurons, several sensory neurons, and the HSN and VC neurons controlling egg-laying.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable high voltage-gated calcium channel activity. Involved in several processes, including determination of left/right asymmetry in nervous system; negative regulation of transforming growth factor beta receptor signaling pathway; and response to stress. Located in presynaptic active zone membrane. Expressed in several structures, including body wall musculature; excretory canal; nerve ring; neurons; and pharyngeal muscle cell. Used to study migraine. Human ortholog(s) of this gene implicated in autoimmune disease of the nervous system (multiple); brain disease (multiple); and episodic ataxia type 2. Is an ortholog of human CACNA1B (calcium voltage-gated channel subunit alpha1 B).
• Biotype: SO:0001217
• Genetic Position: X :-13.7946 ±0.063386
• Length (nt): 52607

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006742

Genomics

15 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T02C5.5b.1	T02C5.5b.1	6848	X: 2710920-2736277
Transcript:T02C5.5g.1	T02C5.5g.1	6851	X: 2710921-2736311
Transcript:T02C5.5c.1	T02C5.5c.1	6441	X: 2710923-2725632
Transcript:T02C5.5f.1	T02C5.5f.1	6894	X: 2710932-2736311
Transcript:T02C5.5q.1	T02C5.5q.1	5958	X: 2711628-2731426
Transcript:T02C5.5h.1	T02C5.5h.1	6204	X: 2711628-2736311
Transcript:T02C5.5i.1	T02C5.5i.1	6150	X: 2711628-2736311
Transcript:T02C5.5j.1	T02C5.5j.1	6003	X: 2711628-2743701
Transcript:T02C5.5k.1	T02C5.5k.1	5949	X: 2711628-2743701
Transcript:T02C5.5l.1	T02C5.5l.1	6009	X: 2711628-2743701
Transcript:T02C5.5m.1	T02C5.5m.1	5955	X: 2711628-2743701
Transcript:T02C5.5n.1	T02C5.5n.1	6384	X: 2711628-2758027
Transcript:T02C5.5o.1	T02C5.5o.1	6360	X: 2711628-2762050
Transcript:T02C5.5p.1	T02C5.5p.1	6516	X: 2711628-2763526
Transcript:T02C5.5a.1	T02C5.5a.1	4660	X: 2716164-2725632

Other

15 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T02C5.5b	T02C5.5b	6084	X: 2711628-2711798
CDS:T02C5.5f	T02C5.5f	6198	X: 2711628-2711798
CDS:T02C5.5g	T02C5.5g	6144	X: 2711628-2711798
CDS:T02C5.5q	T02C5.5q	5958	X: 2711628-2711798
CDS:T02C5.5h	T02C5.5h	6204	X: 2711628-2711798
CDS:T02C5.5j	T02C5.5j	6003	X: 2711628-2711798
CDS:T02C5.5k	T02C5.5k	5949	X: 2711628-2711798
CDS:T02C5.5p	T02C5.5p	6516	X: 2711628-2711798
CDS:T02C5.5a	T02C5.5a	4572	X: 2716252-2716369
CDS:T02C5.5c	T02C5.5c	5736	X: 2711628-2711798
CDS:T02C5.5i	T02C5.5i	6150	X: 2711628-2711798
CDS:T02C5.5l	T02C5.5l	6009	X: 2711628-2711798
CDS:T02C5.5m	T02C5.5m	5955	X: 2711628-2711798
CDS:T02C5.5n	T02C5.5n	6384	X: 2711628-2711798
CDS:T02C5.5o	T02C5.5o	6360	X: 2711628-2711798

18 RNAi Result

• WBRNAi00089786
• WBRNAi00052199
• WBRNAi00052200
• WBRNAi00013890
• WBRNAi00018019
• WBRNAi00022432
• WBRNAi00059965
• WBRNAi00059966
• WBRNAi00059967
• WBRNAi00059968
• WBRNAi00059969
• WBRNAi00059970
• WBRNAi00059971
• WBRNAi00059972
• WBRNAi00059973
• WBRNAi00090152
• WBRNAi00090311
• WBRNAi00089993

952 Allele

• gk963725
• ra606
• ra605
• ra609
• ra612
• ra610
• ra614
• otn12580
• WBVar02063482
• WBVar01757811
• WBVar01757813
• WBVar01757812
• WBVar01757815
• WBVar01757814
• WBVar01757817
• WBVar01757816
• WBVar01757818
• WBVar01693615
• WBVar01693614
• WBVar02048691
• WBVar01824975
• gk899212
• WBVar01824976
• WBVar01601137
• WBVar01601138
• WBVar01601139
• WBVar01601140
• WBVar01601141
• WBVar01601144
• WBVar01601145

1 Chromosome

• WormBase ID: X
• Organism: Caenorhabditis elegans
• Length (nt): 17718942

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006742
• Start: 2710920
• End: 2763526
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrX_2705860..2710919
• Length (nt): 5060
• Chromosome Location: X: 2705860-2710919
• Organism: Caenorhabditis elegans

206 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
	Transcripts that showed significantly increased expression in csr-1a(tor159) comparing to in N2 at 25C.	DESeq2, fold change > 2, p-value < 0.05.	WBPaper00061753:csr-1(tor159)_upregulated_25C
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
Bacteria infection: Staphylococcus aureus MW2. 4 hours of exposure.	Transcripts that showed significantly increased expression after N2 animals had 4 hours of infection by Staphylococcus aureus (MW2).	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:S.aureus-4h_upregulated_N2
	Transcripts that showed significantly increased expression in alg-1(gk214), comparing to in N2.	DESeq2, Fold change > 1.5.	WBPaper00051404:alg-1(gk214)_upregulated
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Transcripts that showed significantly altered expression after 24 hour exposure to stavudine (d4T) starting at L1 lava stage.	DESeq	WBPaper00053302:stavudine_24h_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
	Transcripts depleted in purified oocyte P bodies comparing to in the whole animal.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_WholeAnimal_depleted
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated

13 Expression Patterns

• Primary Identifier: Expr2035998
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6571
• Remark: Also expressed in (comments from author) : Cells in head may be neural. Strain: BC13254
• Reporter Gene: [unc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCATGAATTTTCGCTCCCT] 3' and primer B 5' [GATGTTGCTCGATGGATAGTACC] 3'.
• Pattern: Adult Expression: unidentified cells in head; Larval Expression: unidentified cells in head

• Primary Identifier: Expr6570
• Remark: Strain: BC13255
• Reporter Gene: [unc-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCATGAATTTTCGCTCCCT] 3' and primer B 5' [GATGTTGCTCGATGGATAGTACC] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; Larval Expression: Nervous System; head neurons

• Primary Identifier: Expr12700
• Subcellular Localization: The single copy insertion transgenes showed that GFP::UNC-2, SLO-1::TagRFP, SLO-1::GFP, SLO-2::TagRFP, and GFP::EGL-19 were mainly localized on the plasma membrane of AWC cell bodies and also displayed a punctate pattern along AWC axons.

• Primary Identifier: Expr2616
• Pattern: Expression of the reporter gene was observed in the touch cell AVM and its sister, the interneuron SDQR. A number of neurons in the head and tail regions were also observed to express the unc-2::GFP reporter gene. Neurons identified in the head included the olfactory sensory cells AWC. GFP expression was also observed in both the HSN and VC neurons. Cells expressing GFP in the tail region included the GABAergic neuron DVB. GFP fluorescence was found to be primarily localized within the nervous system. Expression was first observed late in embryogenesis at ~450 min of development when most neurons have been generated, and continued throughout development to the adult stage. GFP expression was observed only a subset of pharyngeal muscle cells but not in other types of muscle tissues. The unc-2 reporter gene was expressed in most motor neurons in the ventral nerve cord, nerve ring motoneurons-interneurons, and the touch cells.

• Primary Identifier: Expr8360
• Remark: Picture: Fig. 4A and B.
• Subcellular Localization: In a total of 44 synaptic profiles, the majority of gold beads recognizing UNC-2 labeled the membrane (59%, 41 of 70 gold beads total) and 37% of membrane-associated beads (15 of 41 gold beads) were specifically within 90 nm of the PD, overlapping the subcellular distribution of UNC-10(Rim).

• Primary Identifier: Expr1032817
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr11892
• Pattern: Upon injection on an UNC-23::YFP translational fusion contract, progeny showed expression in the excretory canal and the body wall muscle cells.
• Subcellular Localization: UNC-23 colocalized with dense bodies and is additionally found in the M-line of the muscular ultrastructure.

• Primary Identifier: Expr13704
• Subcellular Localization: In addition to the UNC-2 presynaptic localization along the neuronal processes in both the central and peripheral nervous system, punctate signals decorate the plasma membrane of neuron somata, including those of A-MNs (VA and DA neurons).

• Primary Identifier: Expr1021669
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1155832
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr12826
• Subcellular Localization: A functional GFP-tagged UNC-2 protein localizes to presynaptic active zones.

• Primary Identifier: Expr2017862
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

28 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006742
• Start: 2710920
• End: 2763526
• Strand: -1

28 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 52607

1 Sequence Ontology Term