WormMine: Gene WBGene00006970

• WormBase Gene ID: WBGene00006970
• Gene Name: zag-1
• Sequence Name: F28F9.1
• Brief Description: zag-1 encodes a homeodomain protein of the ZFH class which consists of a homeodomain flanked by two clusters of C2H2-type zinc fingers and is related to transcriptional repressors encoded by Drosophila zfh-1 and the vertebrate ZEB genes; ZAG-1 is required for locomotion, for neuronal differentiation, and for proper axonal branching and fasciculation; from late embryogenesis through adult stages of development, ZAG-1 is expressed dynamically in head and tail neurons and in the intestinal and anal depressor muscles.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Involved in several processes, including negative regulation of transcription by RNA polymerase II; neuron differentiation; and regulation of cell differentiation. Located in nucleus. Expressed in body wall musculature; enteric muscle; neurons; pharynx; and somatic nervous system. Human ortholog(s) of this gene implicated in Hirschsprung's disease; Mowat-Wilson syndrome; and corneal dystrophy (multiple). Is an ortholog of human ZEB1 (zinc finger E-box binding homeobox 1) and ZEB2 (zinc finger E-box binding homeobox 2).
• Biotype: SO:0001217
• Genetic Position: IV :-2.06697 ±0.013802
• Length (nt): 5727

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00006970

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F28F9.1.1	F28F9.1.1	2243	IV: 3855843-3861569

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F28F9.1	F28F9.1	1791	IV: 3855850-3856008

5 RNAi Result

• WBRNAi00115808
• WBRNAi00045855
• WBRNAi00014064
• WBRNAi00031537
• WBRNAi00115917

88 Allele

• gk963722
• gk963908
• gk851619
• gk953320
• gk414889
• gk730197
• tm435
• rh315
• WBVar01821276
• WBVar00187951
• WBVar00187952
• WBVar00187953
• h4972
• h11082
• h4687
• ok214
• zd85
• zd86
• gk198882
• hd16
• gk958947
• gk198889
• gk198890
• gk198887
• gk198888
• gk198885
• gk198886
• gk198883
• gk198884
• gk198893

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00006970
• Start: 3855843
• End: 3861569
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_3861570..3862032
• Length (nt): 463
• Chromosome Location: IV: 3861570-3862032
• Organism: Caenorhabditis elegans

241 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes significantly enriched (> 2x, FDR < 5%) in a particular cell-type versus a reference sample of all cells at the same stage.	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_larva_enriched
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
Osmotic stress	Transcripts that showed significantly altered expression with 500 mM salt (NaCl) vs 100 mM salt when food was present	DESeq(version 1.10.1), FDR < 0.05.	WBPaper00050726:OsmoticStress_regulated_Food
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Transcripts that showed significantly increased expression after animals were treated with 50uM Rifampicin from day 1 to day 3 adult hermaphradite.	DESeq2(v1.14.1), fold change > 2, p-value < 0.05	WBPaper00055354:Rifampicin_upregulated
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva daf-16(mu86);glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_daf-16(mu86);glp-1(e2141)
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
	Transcripts that showed significantly increased expression in rrf-3(pk1426) comparing to in N2 at embryo stage.	DESeq2v 1.18.1, fold change > 1.5, adjusted p-value < 0.01.	WBPaper00056169:rrf-3(pk1426)_upregulated_embryo
	Transcripts that showed significantly increased expression after four-day-old young adult worms were placed on NGM plates seeded with OP50 in the presence 5% Agaro-oligosaccharides(AGO) for 24 h, comparing to animals grown in the absence of AGO.	Fold change > 2.	WBPaper00064306:Agaro-oligosaccharides_upregulated
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Genes that showed significantly increased expression in daf-2(e1370);hel-1(gk148684) comparing to in hel-1(gk148684)	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_hel-1(gk148684)-background
	Genes that showed significantly increased expression in daf-2(e1370) comparing to in N2.	To identify DEGs, Students t test and the log2 median ratio test were performed to compute t values and median ratios for all the annotated genes. The adjusted P values from each test were computed using an empirical distribution of the null hypothesis, which was obtained from random permutations of the samples. Finally, the adjusted P values from the individual tests were combined to compute the overall P values using Stouffers method , and genes with overall P < 0.05 and fold change > 1.5 were selected as DEGs.	WBPaper00047131:daf-2(e1370)_upregulated_N2-background
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts that showed differential expression between 24 and 26 hours post hatching L2d and dauer committed larvae of daf-9(dh6), triggered by the dafachronic acid (DA) growth hormone. Cluster 3 genes increased expression transiently at 26 hour post hatching.	Benjamini Hochberg corrected q-value < 0.01.	WBPaper00053388:dauer_regulated_Cluster3
Gamma irradiation 100 mGY per hour for 72 hours since L1 larva.	Transcripts that showed significantly increased expression after exposure to 100mGy per hour gamma irradiation from L1 to day 1 adult hermaphrodite stage.	DESeq2, FDR <= 0.05, log2 fold change >= 0.3 or <= -0.3.	WBPaper00058958:100mGy-irradiation-72h_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Transcripts that showed significantly increased expression in hpk-1(pk1393) comparing to in N2 at adult day 2.	DESeq 2, fold change > 2, FDR < 0.05.	WBPaper00065581:hpk-1(pk1393)_upregulated
	Transcripts that showed significantly increased expression in hda-1(ne4752[3xFLAG-Degron-HDA-1]) in gonads dissected from 1-day old adult animals.	Salmon was used to map the mRNA-seq reads with the worm database WS268, and its output files were imported to DESeq2 in R. The differentially expressed genes were filtered by fold change more than 2 and adjusted p-value < 0.05. The scatter plots were generated by the plot function in R.	WBPaper00061479:hda-1(ne4752)_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:dopaminergic-neurons_L3-L4-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:GABAergic-motor-neurons_L2-larva_expressed

20 Expression Patterns

• Primary Identifier: Expr5911
• Remark: Strain: BC13074
• Reporter Gene: [zag-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGATATTGGACACCACCGTC] 3' and primer B 5' [GCGATATCTACGATTTTACCTGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: intestine; stomato-intestinal muscle; anal depressor muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr5912
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC12775
• Reporter Gene: [zag-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAGATATTGGACACCACCGTC] 3' and primer B 5' [GCGATATCTACGATTTTACCTGGA] 3'.
• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Nervous System; nerve ring; ventral nerve cord; head neurons

• Primary Identifier: Expr2629
• Pattern: Examination of the zag-1::ZAG-1-GFP(zdIs39) strain revealed relatively faint GFP expression in neuronal nuclei from mid to late embryogenesis and during the L1 stage. Widespread expression was seen in head and tail regions containing differentiating neurons beginning around the comma stage that diminished as embryogenesis continued. Expression remained in a few neurons at hatching and was typically nonexistent by midlarval stages. Transient expression was also detected in the postembryonic Pn.a neuroblasts and their descendants during the L1. Thus, zag-1 is expressed transiently in most or all neurons during embryogenesis and in the Pn.a-derived ventral cord neurons during the L1.
• Subcellular Localization: neuronal nuclei

• Primary Identifier: Expr2630
• Pattern: zag-1::ZAG-1(213)-GFP (zdIs40) animals displayed a pattern of neuronal expression similar to that of zag-1::ZAG-1-GFP(zdIs39) animals. The GFP signal was detected in neuronal nuclei, showing that the first 213 amino acids of ZAG-1 are sufficient for nuclear translocation.
• Subcellular Localization: neuronal nuclei

• Primary Identifier: Expr2628
• Pattern: Expression was detected in a few nuclei in the head as the embryo reached morphogenesis stage at ~300 minutes of development. Expression was identified in more and more nuclei as development proceeded, so that by the 1 1/2-fold stage a large number of neuronal cells in the head and a few cells in the pharynx expressed zag-1::YFP. At this stage expression was also prominent in motorneurons in the ventral cord and in neurons in tail ganglia. Expression was maintained during the 3-fold stage, but reduced to undetectable levels in most cells before hatching, when only a few cells in the head still expressed zag-1::YFP. In the L1/L2 stage expression was detected transiently in postembryonic motorneurons. Expression was maintained in a few head neurons throughout the entire life cycle. Pzag-1::YFP construct was expressed predominantly in neurons in head and tail ganglia, starting approximately midway through embryogenesis. In some of these neurons expression was maintained throughout development. Additional expression was found consistently in the intestinal and anal depressor muscles during all life stages as well as occasionally in body-wall muscles during embryogenesis.
• Subcellular Localization: zag-1::YFP signal was detected only in the nuclei of cells.

• Primary Identifier: Expr7306
• Pattern: Click the movie links below for interactive 4D movies of a fluorescence reporter. http://glowormnotes.blogspot.com/2009/11/zag-1gfp-transcriptional-fusion.html

• Primary Identifier: Expr7528
• Remark: Clone: pUL#JRH/AE6
• Pattern: Expression is observed from comma stage embryos to adult, in about 20 nerves in the nerve ring, as well as in the dorsal and ventral nerve cords.

• Primary Identifier: Expr15648

• Primary Identifier: Expr13957
• Pattern: Using a fosmid-based GFP translational fusion, we found that zag-1 was expressed in the six TRNs but not in the FLP and PVD neurons. In addition to TRNs, zag-1 was expressed in the AIB, AIM, AIN, AIZ, AVA, AVB, AVD, AVE, AVG, AVK, AVL, M4, M5, RIA, RIB, RIF, RIG, RIM, RIV, RMD, RME, RMF, RMH, SIA, and SMD neurons in the head, all the DD, VD, and VC neurons in the ventral cord, and the DVA, DVB, LUA, PDA, PVC, PVP, PVQ, PVR, and PVT neurons in the tail. zag-1 is also expressed in the serotonergic HSN neurons.

• Primary Identifier: Chronogram76
• Remark: Original chronogram file: chronogram.1087.xml
• Reporter Gene: [F28F9.1:gfp] transcriptional fusion.

• Primary Identifier: Expr2036258
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1032977
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr12071
• Pattern: The zag-1::gfp reporter is indeed expressed in M4 as previously suggested (Expr2628).

• Primary Identifier: Chronogram897
• Remark: Original chronogram file: chronogram.1942.xml
• Reporter Gene: [F28F9.1:gfp] transcriptional fusion.

• Primary Identifier: Chronogram999
• Remark: Original chronogram file: chronogram.2058.xml
• Reporter Gene: [F28F9.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1200171
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr1028524
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2018121
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1170010
• Pattern: Time-lapse fluorescence microscopy was performed, including DIC for morphology. Gene expression patterns were summarized in 4 manners: Average over time, Average over time and at different positions along the anterior-posterior (AP) axis, a voxelized representation over time, and on individual cells overlaid from a reference coordinate dataset (https://doi.org/10.1016/j.ydbio.2009.06.014). The analysis was done with a pipeline based on the multi-purpose image analysis software Endrov (https://doi.org/10.1038/nmeth.2478), which further is needed to browse the raw recording data. Thumbnail movies were also generated, using maximum Z projection for the 3D fluorescence channel. Raw recordings available in the Endrov OST-file format are available at https://www.ebi.ac.uk/biostudies/studies/S-BIAD191?query=S-BIAD191

• Primary Identifier: Expr1149761
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

16 GO Annotation

10 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00006970
• Start: 3855843
• End: 3861569
• Strand: 1

16 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 5727

1 Sequence Ontology Term