WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharyngeal gland cells; Reproductive System; uterus; vulva other; spermatheca uterine valve; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; body wall muscle; excretory cell; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr5453
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC11439 Reporter Gene  [tbb-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGAAACATATCGAGGCTGAAAATC] 3' and primer B 5' [TTGCTGAAAAGGTCGTAATGAAT] 3'.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad. spermathecal-uterine junction sp-ut valve WBbt:0006756
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
H-shaped cell associated with the excretory system, largest cell in C. elegans. excretory cell excretory canal cell WBbt:0005812
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006537 tbb-2 C36E8.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023