WormMine: ExpressionPattern Expr5943

• Pattern: Adult Expression: pharynx; pharyngeal gland cells; Reproductive System; uterus; spermatheca uterine valve; spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons; Larval Expression: pharynx; pharyngeal gland cells; Reproductive System; developing vulva; developing uterus; uterine-seam cell; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; tail neurons
• Primary Identifier: Expr5943
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15410
• Reporter Gene: [dog-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGCCTCTTCAGAGATTTCG] 3' and primer B 5' [TGGATCGCTTGAGGACATAA] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
female genital.	vulva		WBbt:0006748
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.	spermathecal-uterine junction	sp-ut valve	WBbt:0006756
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
The organ in which the eggs are developed and protected until laid.	uterus		WBbt:0006760
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
Secretory gland cell of the pharynx	Pharyngeal gland cell		WBbt:0005788
membranous cell attaches the uterus to the lateral epidermis (seam) and forms a thin laminar process dorsal to the vulva. formed by fusion of eight pi cell progeny and AC.	uterine seam cell	utse	WBbt:0006789
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001049	dog-1	F33H2.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023