WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; developing uterus; gonad sheath cells; body wall muscle; head mesodermal cell; unidentified cells in head; Primary Identifier  Expr5494
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC11019 Reporter Gene  [ost-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGCAATAAACAAAACACATCTGG] 3' and primer B 5' [GACGGCGAATGAAGAGGA] 3'.

13 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003893 ost-1 C44B12.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023