WormMine: ExpressionPattern Expr5475

• Pattern: Adult Expression: Reproductive System; vulval muscle; spermatheca; head mesodermal cell; Nervous System; head neurons; Larval Expression: Reproductive System; developing vulva; head mesodermal cell; Nervous System; head neurons; tail neurons
• Primary Identifier: Expr5475
• Remark: Strain: BC11195
• Reporter Gene: [C39F7.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGCGGCAAAATCTAAA] 3' and primer B 5' [GAGCTCTTCCTCGATTTTTGAA] 3'.

8 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
female genital.	vulva		WBbt:0006748
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00016539	madd-2	C39F7.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023