WormMine: ExpressionPattern Expr5459

• Pattern: Adult Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; uterine muscle; body wall muscle; coelomocytes; unidentified cells in body ; Larval Expression: stomato-intestinal muscle; anal depressor muscle; Reproductive System; distal tip cell; body wall muscle; coelomocytes; unidentified cells in body
• Primary Identifier: Expr5459
• Remark: Strain: BC11970
• Reporter Gene: [C37C3.6a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATGCACTTTACAGCAAAACC] 3' and primer B 5' [ATGGTGTGACGTCTGTAGTTAGGA] 3'.

10 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles.	coelomocyte		WBbt:0005751
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00003242	mig-6	C37C3.6	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023