WormMine: ExpressionPattern Expr5656

• Pattern: Adult Expression: anal depressor muscle; Reproductive System; uterine muscle; vulval muscle; body wall muscle; head mesodermal cell; Nervous System; head neurons; unidentified cells in head; Larval Expression: anal depressor muscle; distal tip cell; head mesodermal cell; Nervous System; head neurons; unidentified cells in head
• Primary Identifier: Expr5656
• Remark: Strain: BC13861
• Reporter Gene: [let-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAACAGATATGAACGGTGGAATTT] 3' and primer B 5' [TCGTTGCTTCATGGTGGTAG] 3'.

11 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00002280	let-2	F01G12.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023