WormMine: ExpressionPattern Expr5757

• Pattern: Adult Expression: intestine; Reproductive System; uterine muscle; spermatheca; gonad sheath cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail ; Larval Expression: intestine; Reproductive System; developing spermatheca; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; unidentified cells in body ;unidentified cells in tail
• Primary Identifier: Expr5757
• Remark: Strain: BC11539
• Reporter Gene: [F14D12.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTTATTTTTGGATTTCTTCCTC] 3' and primer B 5' [TAAGGTTCCAGATTATGTGATGTT] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
	reproductive system		WBbt:0005747
region of the body by which tissues, cells or cell parts are classified	body region		WBbt:0005738

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00006411	octr-1	F14D12.6	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023