WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; Larval Expression: rectal epithelium; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in tail ; Primary Identifier  Expr5749
Remark  Strain: BC13826 Reporter Gene  [idh-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGGATTGAATTTCTCAGTTTTGA] 3' and primer B 5' [TTGCGATGCTGAAAGAAATG] 3'.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
female genital. vulva   WBbt:0006748
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
posterior region, from rectum to the end tail   WBbt:0005741
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00002262 ldh-1 F13D12.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023