WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine muscle; vulval muscle; spermatheca; head mesodermal cell; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; head mesodermal cell; Nervous System; head neurons; Primary Identifier  Expr5632
Remark  Strain: BC10287 Reporter Gene  [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.

12 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents. anal depressor muscle dilator muscle WBbt:0004292
a saddle-shaped muscle cell that encircles the intestinal-rectal valve anal sphincter muscle lineage name: ABprpppppap WBbt:0005798
muscle lining of the uterine wall. uterine muscle   WBbt:0005342
Head mesodermal cell, function unknown head mesodermal cell hmc WBbt:0004697
  reproductive system   WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_L lineage name: ABplpppppaa WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus mu_int_R lineage name: MSppaapp WBbt:0003822

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004207 ptb-1 D2089.4 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023