WormMine: ExpressionPattern Expr5632

• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine muscle; vulval muscle; spermatheca; head mesodermal cell; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; anal sphincter; head mesodermal cell; Nervous System; head neurons
• Primary Identifier: Expr5632
• Remark: Strain: BC10287
• Reporter Gene: [ptb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGTCGAAAATTGCCTCAGAA] 3' and primer B 5' [ATGCTCACCTTGGTGATGTG] 3'.

12 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
a saddle-shaped muscle cell that encircles the intestinal-rectal valve	anal sphincter muscle	lineage name: ABprpppppap	WBbt:0005798
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
	reproductive system		WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004207	ptb-1	D2089.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023