WormMine

WS295

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ; Primary Identifier  Expr7104
Remark  Strain: BC14299 Reporter Gene  [nhr-112::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGAAAACGATTAGGTGATTT] 3' and primer B 5' [GCAGATTTTGCAGATTTTGAGA] 3'.

18 Anatomy Terms

Definition Name Synonym Primary Identifier
female genital. vulva   WBbt:0006748
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad. spermathecal-uterine junction sp-ut valve WBbt:0006756
Epidermal layer. hypodermis epidermis WBbt:0005733
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad anterior distal tip cell gon herm dtc A WBbt:0004520
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad posterior distal tip cell gon herm dtc P WBbt:0004506
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct. excretory gland cell exc gl WBbt:0005776
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800
  reproductive system   WBbt:0005747
region of the body by which tissues, cells or cell parts are classified body region   WBbt:0005738

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003702 nhr-112 Y70C5C.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023