WormMine: ExpressionPattern Expr5176

• Pattern: Adult Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; Reproductive System; spermatheca uterine valve; head mesodermal cell; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; arcade cells; intestine; head mesodermal cell; coelomocytes; Nervous System; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr5176
• Remark: Also expressed in (comments from author) : GLR head neurons are expressing (Hall Lab, 2005). Strain: BC14109
• Reporter Gene: [snx-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGAAAAACTGAAGGTTGGTTGT] 3' and primer B 5' [CTTCCGACAAGATTTCCAGG] 3'.

13 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
A valve tissue that connects the spermatheca and the uterus of a hermaphrodite gonad.	spermathecal-uterine junction	sp-ut valve	WBbt:0006756
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages.	intestine	gut	WBbt:0005772
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
Secretory gland cell of the pharynx	Pharyngeal gland cell		WBbt:0005788
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis).	arcade cell		WBbt:0005793
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles.	coelomocyte		WBbt:0005751
posterior region, from rectum to the end	tail		WBbt:0005741
Head mesodermal cell, function unknown	head mesodermal cell	hmc	WBbt:0004697
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00004927	snx-1	C05D9.1	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023