WormMine: ExpressionPattern Expr5857

• Pattern: Adult Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; uterine muscle; vulval muscle; vulva other; excretory cell; Nervous System; head neurons; Larval Expression: pharynx; pharyngeal-intestinal valve; stomato-intestinal muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; excretory cell; Nervous System; head neurons
• Primary Identifier: Expr5857
• Remark: Also expressed in (comments from author) : No comments. Strain: BC16095
• Reporter Gene: [cdh-4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTTTTCTGAATCTACTTTGAGG] 3' and primer B 5' [ACCCGATGTTTCTTGATTATTTTT] 3'.

14 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
female genital.	vulva		WBbt:0006748
A group of six equivalent cells forms a tightly constructed `valve` that links the posterior bulb of the pharynx to the anterior four cells of the intestine. These six cells comprise a small epithelial channel with a cuticular lining in continuity with the pharyngeal cuticle and link the lumen of the pharynx to the large lumen of the anterior intestine.	pharyngeal-intestinal valve	cardia	WBbt:0005767
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
Posterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	posterior distal tip cell	gon herm dtc P	WBbt:0004506
Anterior distal tip cell, inhibit meiosis in neighbouring germ cells, lead gonad during morphogenesis, herm gonad	anterior distal tip cell	gon herm dtc A	WBbt:0004520
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
H-shaped cell associated with the excretory system, largest cell in C. elegans.	excretory cell	excretory canal cell	WBbt:0005812
muscle lining of the uterine wall.	uterine muscle		WBbt:0005342
epithelium connecting intestine and anus.	rectal epithelium		WBbt:0005800
	reproductive system		WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00000396	cdh-4	F25F2.2	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023