WormMine

WS294

Intermine data mining platform for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: pharynx; intestine; rectal epithelium; developing vulva; hypodermis; seam cells; Nervous System; head neurons; amphid socket cells; neurons along body; unidentified cells in head; Primary Identifier  Expr6503
Remark  Also expressed in (comments from author) : Embryo and adult incomplete. To be updated. Strain: BC14319 Reporter Gene  [R11A8.7a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCAGTTTTTCTCATATTTGTTTCT] 3' and primer B 5' [TTTCTAATGGAATGAGGTGATTGA] 3'.

12 Anatomy Terms

Definition Name Synonym Primary Identifier
A chain of very large cuboidal cells forming a wide central lumen in which food arrives from the posterior pharynx, is digested, and from which waste products proceed to the rectum. Intestinal rings form in groups of two and four cells surrounding the common lumen; thus the epithelium is only one cell deep at any point, with neighboring cells firmly secured to their neighbors by apical adherens junctions. These cells have very large nuclei and many large vacuoles, yolk granules, and other inclusions; the latter increase in number and electron density as the animal ages. intestine gut WBbt:0005772
female genital. vulva   WBbt:0006748
Epidermal layer. hypodermis epidermis WBbt:0005733
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
Amphid socket cell, left AMsoL lineage name: ABplpaapapa WBbt:0003931
Amphid socket cell, right AMsoR lineage name: ABprpaapapa WBbt:0003929
anterior-most body region containing the pharynx. head   WBbt:0005739
epithelium connecting intestine and anus. rectal epithelium   WBbt:0005800

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00011240 mask-1 R11A8.7 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023