WormMine: ExpressionPattern Expr6499

• Pattern: Adult Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: pharynx; stomato-intestinal muscle; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; unidentified cells in head; unidentified cells in tail
• Primary Identifier: Expr6499
• Remark: Strain: BC13354
• Reporter Gene: [gpa-7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGATGCACAAACATTTTGATTTT] 3' and primer B 5' [GCAGTGACCGATTTGTGCT] 3'.

16 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion.	body wall musculature	body muscle	WBbt:0005813
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
muscle associated with hermaphrodite vulva.	vulval muscle		WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine.	pharynx	esophagus	WBbt:0003681
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
a single, H-shaped cell which lies just above the anus and connects the roof of the anal canal to the dorsal bodywall; its contractions act to increase the size of the anal opening by lifting the roof of the rectum and hence facilitate expulsion of intestinal contents.	anal depressor muscle	dilator muscle	WBbt:0004292
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
posterior region, from rectum to the end	tail		WBbt:0005741
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis.	gonadal sheath cell		WBbt:0005828
anterior-most body region containing the pharynx.	head		WBbt:0005739
	reproductive system		WBbt:0005747
left intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_L	lineage name: ABplpppppaa	WBbt:0003833
right intestinal muscle cell, attach to intestine and body wall anterior to anus	mu_int_R	lineage name: MSppaapp	WBbt:0003822

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00001669	gpa-7	R10H10.5	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023