WormMine: ExpressionPattern Expr6130

• Pattern: Adult Expression: Reproductive System; vulva other; spermatheca; excretory gland cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; neurons along body; tail neurons; Larval Expression: excretory gland cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; pharyngeal neurons; neurons along body; tail neurons
• Primary Identifier: Expr6130
• Remark: Also expressed in (comments from author) : No comments. Strain: BC15931
• Reporter Gene: [F52A8.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTCGAGCGTTATTGCCAG] 3' and primer B 5' [GGTCGTTAAAAGGATTTTTGGA] 3'.

13 Anatomy Terms

Definition	Name	Synonym	Primary Identifier
neuron with cell body associated with the ventral nerve cord.	ventral cord neuron	ventral cord motoneuron	WBbt:0005300
female genital.	vulva		WBbt:0006748
an accordion-like tube that contains sperm and is the site of oocyte fertilization.	spermatheca		WBbt:0005319
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities.	nervous system		WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx.	head neuron		WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum.	tail neuron		WBbt:0006759
gland cell of the secretory-excretory system, sends processes to ring, opens into excretory duct.	excretory gland cell	exc gl	WBbt:0005776
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses.	neuron	neurone	WBbt:0003679
neuron of the pharyngeal nervous system.	pharyngeal neuron		WBbt:0005439
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes.	nerve ring	circumpharyngeal nerve ring	WBbt:0006749
a bundle of nerve processes that runs along the dorsal mid-line of the animal.	dorsal nerve cord	dorsal cord	WBbt:0006750
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA.	lateral nerve cord		WBbt:0006769
	reproductive system		WBbt:0005747

1 Genes

WormBase Gene ID	Gene Name	Sequence Name	Organism
WBGene00009917	glb-18	F52A8.4	Caenorhabditis elegans

2 Life Stages

Remark	Definition	Other Name	Public Name	Primary Identifier
	The stage that begins when a C.elegans individual is fully-developed and has reached maturity.		adult Ce	WBls:0000041
	A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood.		larva Ce	WBls:0000023