|
|
|
Expr11005
|
RGA-4 is expressed in the germ line and in the early embryo. Expression seems to cease around the 100- to 200-cell stage. |
|
|
|
|
Expr14760
|
We observed cytosolic tagged GCK-2 throughout vulval development (VPCs). We observed the expression of GCK-2 in all tissues, including the germline and embryos in the adult hermaphrodite. |
|
|
|
|
Expr11951
|
|
At a higher resolution, ZTF-8 signal is observed as foci both on chromosomes as well as in the nucleolus. Specifically, 34% of ZTF-8 foci at the premeiotic tip, and 78% at late pachytene, localize to DAPI-stained chromosomes, with the remaining foci being localized to the nucleolus. ZTF-8 localization is also observed in gut and embryonic nuclei. ZTF-8 localizes to both chromatin and the nucleolus. ZTF-8 signal is observed in mitotic nuclei at the gonadal distal tip (premeiotic tip). This signal is then reduced upon entrance into meiosis (leptotene/zygotene stages = transition zone) and remains weak through the mid-pachytene stage. However, the ZTF-8 signal increases once again in late pachytene nuclei and persists through late diakinesis oocytes. This dynamic pattern of expression suggests regulation of ZTF-8 during meiotic prophase. |
|
|
|
Expr11911
|
Beginning at the onset of excretory canal formation and continuing through adult stages, RAL-1 was present along the length of the excretory canal. YFP-RAL-1 was also expressed maternally and therefore were present in cells of the early embryo. |
YFP-RAL-1 displayed a uniform plasma membrane enrichment. |
|
|
|
Expr9636
|
zeel-1 is expressed in the embryo. Yet its expression is transient. By single-molecule FISH, zeel-1 expression begins at the eight-cell stage, peaks at approximately the 150-cell stage, and then turns off. |
|
|
|
|
Expr9637
|
Transient expression was also observed for a GFP-tagged version of ZEEL-1, whose levels peaked during mid-embryogenesis, but whose expression was not observed in late-stage embryos, nor larvae or adults (unpublished data). Within embryos, ZEEL-1::GFP was expressed in all or almost all cell types. |
The protein localized most strongly to cell membranes, consistent with ZEEL-1 having an N-terminal transmembrane domain. In some tissues, such as the developing pharynx and intestine, ZEEL-1::GFP appeared more concentrated at the apical face. |
|
|
|
Expr11746
|
The smut-1 promoter drives expression of mCherry predominantly in germ cells. Expression was also relatively strong in developing embryos. |
|
|
|
|
Expr10555
|
In WT animals, SID-5 was detected by immunohistochemistry in somatic cell types including intestine, muscle, neurons, somatic gonad, and embryos, but not in the germline. Transcriptional and translational sid-5 GFP reporters were expressed in most, if not all, somatic tissues. The translational fusion protein appeared to associate with membranes in the cytoplasm of intestinal cells. |
SID-5 associates, at least partially, with late endosomes. |
|
|
|
Expr13710
|
The cisd-1 (pnls27) animals showed GFP expression in the germline of L4 and young adults. The GFP expression was also observed in embryonic blastomeres, and the muscle and intestinal cells within larvae and young adults. |
|
|
|
|
Expr9611
|
GFP expression driven by utx-1 promoter (Putx-1::gfp) displays high intensities in neurons, intestine, embryo, and pharynx, relative low intensities in muscle, germline, and tail. The expression of utx-1 showed a clear bimodal pattern. During young adulthood (day 0 to day 5), the utx-1 expression level was very low, then after day 7 of adulthood the level dramatically increased, and steadily increased to a higher level by day 15. |
|
|
Feature : lin-11 enhancer region, mpB. Reporter gene fusion not specified. |
|
Expr11407
|
The mpB is located within a 2.0 kb region that is necessary for the expression of Cel-lin-11 in embryonic neurons. |
|
|
Temporal description. |
|
Expr11434
|
ATG-16.1::GFP was diffusely expressed in the cytoplasm in most, if not all, cells during embryogenesis. At post-embryonic stages, ATG-16.1::GFP was widely expressed, including in neurons, pharyngeal muscles, body wall muscle cells and intestinal cells. |
|
|
Temporal description. |
|
Expr11435
|
ATG-16.2::GFP was diffusely expressed in the cytoplasm in most, if not all, cells during embryogenesis. At post-embryonic stages, ATG-16.2::GFP was widely expressed, including in neurons, pharyngeal muscles, body wall muscle cells and intestinal cells. |
|
|
Temporal description |
|
Expr11487
|
The die-1 fosmid reporter is initially expressed very broadly throughout the developing embryo, including the hypodermis, where die-1 acts to ensure ventral enclosure during gastrulation. Mirroring antibody staining, reporter expression of the fosmid reporter vanishes at approximately 460 min of embryonic development. die-1 expression then reinitiates in many neurons,including both ASEL and ASER; shortly thereafter, expression in ASER becomes undetectable. ASEL-restricted expression is maintained throughout the embryonic, larval, and adult stages. die-1 is also expressed in an asymmetric manner in the AWC olfactory neuron pair. Most adult animals show a strong bias of expression of die-1 to either the left or right AWC neuron. This antisymmetric die-1 expression is already evident in late embryos when the initial decision of AWC asymmetry control is made. ASEL-specific expression of die-1can be observed before any AWC expression of die-1 is observed. Expression of the die-1 fosmid reporter correlates with the AWC OFF state. |
|
|
|
|
Expr15929
|
XPF-1 is expressed ubiquitously in nuclei of different tissues, including neurons, muscles, hypodermis, and intestine, as well as germ cells and embryos. |
|
|
|
|
Expr9920
|
Ptdp-1::YFP was expressed in embryos before hatching. In both larvae and adults, the reporter expression was found in multiple C. elegans tissues, including body wall muscles, pharynx, and neurons. |
|
|
|
|
Expr1887
|
Antibody: The staining of anti-PTP-3 antisera in wild-type animals was weaker, but otherwise identical in pattern to the expression pattern of the PTP-3B::GFP transgenes. Reporter_gene: PTP-3B::GFP transgenes showed widespread expression in embryos. The earliest stage GFP was detected in these embryos was during late gastrulation (approximately 250-300 minutes after first cleavage at 20C). PTP-3B::GFP expression was observed uniformly on the surface of most, possibly all, cells in the embryo during gastrulation cleft closure and epidermal enclosure. In later embryos, larvae and adults PTP-3B::GFP expression became highest in the nervous system, including the nerve ring, dorsal cord, and ventral cord. Reporter_gene: The Pptp-3A::GFP construct expressed GFP from the comma stage (380 minutes) onwards in many neurons that also expressed PTP-3B::GFP. Thus, PTP-3 isoforms are expressed in many tissues during early development, and later become restricted to the nervous system and epithelial tissues. |
PTP-3B::GFP was expressed in many but not all neurons, within which it was localized to neurites. In later embryos and larvae PTP-3B-GFP became localized within epidermal cells, apparently to adherens junctions. |
|
|
|
Expr10997
|
Expression of nfi-1-GFP reporter constructs was observed in embryos, intestinal cells, body wall muscles, pharynx, egg-laying muscles, several head and tail neurons. |
|
|
|
|
Expr12103
|
Eggs already showed the corresponding GFP fluorescence, with more and more tissues following during development (L1 larval stage: pharynx, excretory cell, some sensory neurons; L2-L4 larval stages: intestine, rectal sensory neurons; adult worms: longitudinal muscles, gonads). The rare males showed GFP expression in their spermathecae. Within the anterior part of the nervous system, GFP expression was detected in the pharyngeal nerve ring and in some sensory neurons. Within its posterior part, lumbar ganglia and the dorso-rectal ganglion showed GFP expression. |
|
|
|
|
Expr1425
|
sma-1 transcripts are present in the embryonic epidermis at the start of morphogenesis. In a population of mixed-stage embryos hybridized with a sma-1 antisense probe, sma-1 RNA was not observed in pre-morphogenesis embryos. In particular, there was no sign of sma-1 transcripts in early cleavage-stage embryos (2-8 cells). In embryos just beginning morphogenesis, sma-1 RNA was present in cells along the dorsal surface of the embryo, corresponding to the location of the epidermis at this point in development. Examining embryos at successive stages of morphogenesis, it was found that sma-1 RNA changed in a pattern that exactly matched the movements of the migrating epidermal cells. During early morphogenesis, when the epidermal cell sheet spreads over the lateral surfaces of the embryo, sma-1-expressing cells were observed on the dorsal and lateral surfaces of the embryo, but not on the ventral surface or in the head region, which at this stage are not yet covered by the spreading epidermis. In cross-section, it can be seen that the sma-1 RNA is located in the outermost cell layer of the embryo. As morphogenesis progresses, the spreading epidermis encloses first the ventral surface of the embryo and then the head as the embryo bends ventrally and begins to elongate. In embryos at this stage of morphogenesis, there was a corresponding pattern in which sma-1 RNA was seen first on the ventral surface and then on the anterior (head) surface of the embryo. At the same time, the overall level of sma-1 RNA rapidly decreased as the embryo began to elongate. sma-1 RNA in the epidermis was not observed in embryos past the 2-fold stage. In addition to sma-1 expression in the cells of the epidermis, a line of sma-1 RNA was observed in the interior of the embryo, oriented along the anterior-posterior axis. Based on its location, this sma-1 RNA seems located in the developing digestive tract of the embryo, consisting of the pharynx and intestine. During early morphogenesis, it is difficult to determine the anterior extent of sma-1 staining in the interior of the embryo, but as the embryo begins to elongate, the level of sma-1 RNA increases and at the 1.5-fold stage sma-1 RNA is clearly present in both the pharynx and intestine. A lower level of pharyngeal/intestinal RNA was observed in 2- to 3-fold stage embryos. In these older embryos, sma-1 RNA was also found in the excretory cell and in an unidentified cell near the anus. Expression of sma-1 RNA was observed in several epithelial tissues: epidermis, pharynx, intestine and excretory cell. sma-1 RNA was not seen in the body wall muscle cells, which are arranged in four stripes underlying the epidermis. The highest level of sma-1 RNA was observed in the epidermis during the early stages of morphogenesis, prior to when differences are observed between development of wild-type and sma-1 embryos. |
|
|
The authors have changed the name of the protein described in the paper from CUP-1 to ChUP-1, given that CUP-1 was already taken by a family of genes with unknown function. |
[ChUP-1::GFP] translational fusion. ChUP-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction. [chup-1::GFP] translational fusion. chup-1 stop codon was removed by PCR using the following primers: TCTAGAATGAGGACCTCACAGGCG and GGATCCCCTCCGAAAACTCGAATTGTATTCC. The product was cloned in pEGFP-N1 from Clontech (Mountain View, CA. USA) and the chimeric vector was transfected in HEK293-FT cells using Lipofectamine/PLUS Reagent (Invitrogen) in 35 mm dishes according to manufacture instruction. |
Expr10014
|
ChUP-1 expression was detected in all developmental stages by RT-PCR and no differences were detected in mRNA levels. The ChUP-1::GFP signal was especially strong all along the worm intestine. The pharynx also showed GFP signal, especially at the terminal bulb and presumably, the excretory gland cells. Although fluorescence was not as strong as that observed in other structures, GFP was also observed in embryos. |
The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4- 64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, inmmunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92). The subcellular localization of ChUP-1 was determined in human embryonic kidney cells (HEK293 FT). In general, the ChUP-1-GFP signal was detected in a punctuated pattern resembling the vesicle-like structures observed in C. elegans. Remarkably, GFP signal colocalized with the plasma membrane marker FM4-64 (R = 0.47). Colocalization signal was also observed in endocytic vesicles, as a result of FM4-64 endocytosis. These structures might correspond to early endosomes. We observed a strong colocalization signal between ChUP-1-GFP and the endosome marker RhoB (R=0.91) and Lysosotracker (R=0.84) but not with mitochondrial or nuclear markers (data not shown). Additionally, immunostaining against the human Golgin-97 showed the presence of ChUP-1-GFP in the Golgi (R = 0.92). |
|
|
|
Expr2304
|
Anti-MEC-8 serum recognized a nuclear antigen in wild-type C. elegans embryos. The youngest embryos to exhibit immunostaining contained about 50 cells, all of which showed nuclear staining. All nuclei showed staining in embryos containing up to hundreds of nuclei. Two mec-8 mutants, mec-8(u391) and mec-8(u314), failed to show any trace of nuclear staining at any stage of development. During the late proliferative phase of embryogenesis, prior to the onset of morphogenesis, MEC-8 staining was confined largely to hypodermal nuclei. Prior to this shift, MEC-8 was found in most nuclei, including nuclei that were also marked with an hlh-1::lacZ reporter, which is expressed in early blastomeres that subsequently produce only body wall muscle cells; but MEC-8 was not detectable in body muscles after the onset of morphogenesis. In L1-L4 larvae, MEC-8 was detected by anti-MEC-8 serum in the nuclei of the large hypodermal syncytium, hyp7, that covers most of the worm. This staining was fainter than the staining of the embryonic hypodermal nuclei, became even fainter during later larval development and was undetectable in adults. The nuclei of head hypodermal cells not fused with hyp7 (hyp4 and hyp5 nuclei in particular) stained well with anti-MEC-8 in all larval stages and in adults. Anti-MEC-8 also stained the nuclei of many neurons in the head (probably including chemosensory neurons); a few neurons in the central body region [including the ALM and AVM touch neurons, and neurons in the post-deirid]; vulval nuclei in L4 and adult stage hermaphrodites; anterior- and posterior-most intestinal nuclei; and other unidentified nuclei in the head and tail. The anterior-most muscle nuclei in the heads of larvae had low but detectable levels of MEC-8, but none of the muscle cells in the main body appeared to stain with anti-MEC-8. |
nuclear staining |
|
|
|
Expr14883
|
Although transcriptional reporter signal was not detected in embryonic nuclei, FAMK-1 protein was detected by immunoblotting of embryo extracts. |
|
|
|
|
Expr11402
|
lsy-27 is expressed very broadly throughout the embryo. Expression can already be observed in one-cell embryos and continues to about the comma stage, when expression starts to fade out. By the comma stage, most neurons, including ASEL/ASER, have terminally divided and begun to terminally differentiate. No expression is observed after hatching in larvae or in adult animals. Through colocalizing expression of the lsy-27 reporter with an ASE-specific mCherry reporter, we confirmed that lsy-27 is expressed in both ASE neurons in the comma-stage embryo when ASE laterality is established. |
|
|
|
|
Expr15445
|
The endogenous C-terminal TOP-2::GFP is expressed in nuclei throughout the worm soma, germ line, and in developing embryos. In the germ line, TOP-2 is expressed from the mitotic zone at the distal tip to the most proximal oocyte, which is preparing for fertilization. |
|
|
|
|
Expr10192
|
|
A TG-4.1::GFP was expressed in the cytoplasm of most cells during embryogenesis. |
|
|
|
Expr15978
|
Live imaging of worms expressing wrmScarlet::TDPT-1 showed that TDPT-1 is expressed in both the soma and germ line. TDPT-1 was found within nuclei throughout the germ line and within the spermatheca, somatic cell nuclei, and in the nuclei of developing embryos in hermaphrodites at 20°C. |
|
|
Integrants (bIs1, BIs2, bIs3 and bIs4) made by injecting N2 animals (transgenic marker: rol-6). All gave same results. |
|
Expr520
|
Expressed in late-stage oocytes. Pseudocoelomic expression in very young and very old hermaphrodites. |
|
|
|
|
Expr10953
|
rpl-11.2 mRNA is detectable in a subset of cells in the embryo, with high levels in what appear to be intestinal cells in later embryonic stages. During larval development, rpl-11.2 mRNA is weakly detectable, with somewhat higher levels in the adult. |
|
|
Temporal description |
|
Expr11524
|
|
By antibody staining, MCM-4 was found to be expressed in dividing cells during all stages of development in wild-type animals. Embryos showed the highest levels of MCM-4 expression, in agreement with the fact that more than half of the somatic cells are formed during embryogenesis. Even dauer larvae that had been arrested in cell division for 2 weeks still contained detectable MCM-4 protein levels. These results suggest that a pool of MCM-4 is retained during prolonged periods of quiescence, so that MCM-4 might function in the re-initiation of DNA synthesis when conditions improve. Immunostaining of wild-type animals for MCM-4 showed strong nuclear staining in the gonad, embryos and postembryonic lineages. MCM-4 was detectable in sperm and accumulated during oocyte maturation in the nucleus but did not show overlap with the condensed chromosomes in diakinesis of meiotic prophase. MCM-4 was not chromatin-associated during MeiosisI of the fertilized oocyte, and the first polar body did not contain MCM-4. This finding is consistent with the absence of S phase between Meiosis I and -II. The second polar body and maternal pronucleus received some MCM-4. Subsequently, embryonic cells in interphase showed strong nuclear staining. In prophase, MCM-4 localization did not overlap with the condensing chromosomes. Upon nuclear envelope degradation, MCM-4 became diffusely localized throughout the cell and clearly did not co-localize with the metaphase-aligned chromosomes. MCM-4 remained cytoplasmic at the onset of anaphase; however, chromatin association became apparent in late anaphase. These data show that chromosome association of MCM-4 is tightly controlled, consistent with origin licensing taking place at the end of mitosis and disappearing during S phase. Similar observations were made during larval divisions. Matching the MCM-4::mCherry reporter, endogenous MCM-4 expression was detectable prior to and during mitosis. Staining of synchronized L1 animals revealed the timing of MCM-4 expression, which in general preceded mitosis by 1-2 h. After 5 h of L1 development at 20 C, MCM-4 immunostaining was predominantly detected in the epithelial seam cells, Q neuroblast daughters and gonad primordium. The somatic gonad precursor cells Z1 and Z4 showed nuclear staining, while the mitotically arrested germline precursor cells Z2 and Z3 showed diffuse cytoplasmic staining. At 6 hours of L1 development, the mesoblast (M) also stained strongly as well as the most anterior ventral cord precursors cells (W, P1 and P2). Subsequently at 7 h, additional P cells showed nuclear MCM-4 expression, which became apparent prior to migration of the nucleus into the ventral nerve cord. At 8 h of L1 development, the intestinal nuclei showed MCM-4 expression, which preceded nuclear division by at least 4 h. At subsequent time points, daughter cells that continued division, such as the Pn.a and M descendants, retained strong nuclear staining. L2 animals stained at 16 h of larval development showed strong MCM-4 expression in the gonad, the H1.a, H2.p, V1-6.p and T.ap seam cells and, weakly, the intestinal nuclei (data not shown). Importantly, MCM-4 staining did not overlap with DNA in prophase and metaphase, while in late anaphase co-localization with the chromosomes was clearly detectable. Similar to our observations with the MCM-4::mCherry reporter, we could not detect any asymmetry in MCM-4 segregation. Thus, even if only one daughter cell continued cell division, both daughters received a similar amount of MCM-4in mitosis. Furthermore, the MCM-4protein became undetectable during quiescence, i.e. the P3.p-P8.p daughter cells that resume DNA replication in the L3 stage did not show detectable expression in the L2 stage. Altogether, our reporter gene and antibody staining analysis show that MCM-4 is dynamically expressed and localized during larval development as well as during different phases of the cell cycle. Expression of MCM-4::mCherry was specifically induced in all postembryonic blast cell lineages well before mitotic entry, at the expected time of S-phase induction. The fusion protein localized to the cell nucleus until degradation of the nuclear envelope in prometaphase, at which point MCM-4 became diffusely localized through the cell. This diffuse localization indicates that MCM-4 is not chromatin-associated in mitosis. MCM-4::mCherry did not disappear upon completion of mitosis but was segregated to both daughter cells. Even cells that permanently withdrew from cell division, such as the motor neurons of the ventral nerve cord, initially retained MCM-4::mCherry expression. However, this expression subsequently disappeared in differentiated cells as well as in cells that temporarily arrested cell division, such as the Pn.p vulval precursor cells in the ventral cord. These experiments indicate that mcm-4 is transcriptionally activated at approximately the time of G1/S transition and that MCM-4 protein is segregated to both daughter cells in mitosis. |
