WormMine: Gene WBGene00001132

• WormBase Gene ID: WBGene00001132
• Gene Name: alp-1
• Sequence Name: T11B7.4
• Brief Description: alp-1 encodes the C. elegans ortholog of the ALP (alpha-actininassociated LIM protein)-Enigma family of proteins that are found at sites of actin filament anchorage, such as the muscle Z disk; in C. elegans, alp-1 is required for maintenance of actin filament organization and for stabilizing muscle contraction; ALP-1 co-localizes with alpha-actinin at body wall muscle dense bodies, and its localization is dependent upon alpha-actinin.
• Organism: Caenorhabditis elegans
• Automated Description: Predicted to enable actin binding activity and muscle alpha-actinin binding activity. Involved in determination of adult lifespan and nematode pharyngeal pumping. Located in several cellular components, including actin filament bundle; basal part of cell; and striated muscle dense body. Expressed in body wall musculature; hypodermis; marginal cell; and pharyngeal muscle cell. Used to study cardiomyopathy and myopathy. Human ortholog(s) of this gene implicated in dilated cardiomyopathy 1C; distal myopathy; myofibrillar myopathy 4; and myotonic dystrophy type 1. Is an ortholog of human PDLIM5 (PDZ and LIM domain 5).
• Biotype: SO:0001217
• Genetic Position: :±
• Length (nt): 9753

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00001132

Genomics

5 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:T11B7.4e.1	T11B7.4e.1	2268	IV: 8852494-8862223
Transcript:T11B7.4a.1	T11B7.4a.1	1416	IV: 8852500-8860497
Transcript:T11B7.4d.1	T11B7.4d.1	4487	IV: 8852500-8862228
Transcript:T11B7.4b.1	T11B7.4b.1	2168	IV: 8852500-8862246
Transcript:T11B7.4c.1	T11B7.4c.1	2399	IV: 8854530-8862097

Other

5 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:T11B7.4b	T11B7.4b	1938	IV: 8852514-8852612
CDS:T11B7.4d	T11B7.4d	4275	IV: 8852514-8852612
CDS:T11B7.4e	T11B7.4e	2055	IV: 8852514-8852612
CDS:T11B7.4c	T11B7.4c	2316	IV: 8854546-8854577
CDS:T11B7.4a	T11B7.4a	1278	IV: 8852514-8852612

10 RNAi Result

• WBRNAi00001688
• WBRNAi00002262
• WBRNAi00053101
• WBRNAi00053102
• WBRNAi00009156
• WBRNAi00079868
• WBRNAi00018585
• WBRNAi00035468
• WBRNAi00080557
• WBRNAi00075890

152 Allele

• gk964278
• gk964500
• gk962765
• gk962666
• gk963722
• tm948
• WBVar01825784
• gk207941
• WBVar00191238
• gk207939
• gk207940
• WBVar00191239
• WBVar00191240
• h12150
• tm1137
• WBVar01453482
• WBVar01453481
• gk961071
• WBVar02114912
• WBVar02114911
• WBVar01453488
• WBVar01453487
• WBVar02090067
• WBVar01453489
• WBVar01453483
• WBVar01453486
• WBVar01453485
• WBVar01453491
• WBVar01854905
• WBVar01854904

1 Chromosome

• WormBase ID: IV
• Organism: Caenorhabditis elegans
• Length (nt): 17493829

1 Chromosome Location

• Feature . Primary Identifier: WBGene00001132
• Start: 8852494
• End: 8862246
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

213 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts that showed significantly decreased expression at 5-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day5_vs_Day1_downregulated
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Genes that are significantly up regulated in tdp-1(ok803) poly(A) RNA-seq verses in N2.	DESeq v1.14, with cut-off p-value < 0.05 and FDR < 0.1.	WBPaper00046012:tdp-1(ok803)_upregulated
	Transcripts that showed significantly decreased expression at 11-days-post L4 adult N2 hermaphrodites comparing to 1-day-post L4 adult N2 hermaphrodites.	DESeq2, fold change > 2, FDR < 0.05	WBPaper00065835:Day11_vs_Day1_downregulated
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Genes up regulated in alg-1(gk214) comparing to in N2.	Differential expression was assessed using an empirical Bayes statistics using the eBayes function.	WBPaper00040823:alg-1(gk214)_upregulated
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts that showed significantly decreased expression in day 3 adult hermaphrodite comparing to in L4 larva glp-1(e2141) animals.	Fold change > 2, FDR < 0.05	WBPaper00064088:Day-3-adult_vs_L4_downregulated_glp-1(e2141)
Bacteria infection: Bacillus thuringiensis	Transcripts that showed significantly increased expression in N2 animals infected by bacteria BMB171/Cry5Ba, an acrystalliferous Bt mutant BMB171 transformed with toxin gene cry5Ba on the shuttle vector pHT304, comparing to N2 animals infected by BMB171/pHT304.	N.A.	WBPaper00064229:B.thuringiensis-Cry5Ba_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
Dietary restriction	Transcripts that showed significantly decreased expression after N2 animals were under dietary restriction (DR, OP50 OD = 0.1) from 3-day post L4 till 6-day post L4 adult hermaphrodite stage, comparing to under ad libtum (AL, OP50 OD = 3) condition.	Bioconductor package edgeR, p < 0.05.	WBPaper00056443:DietaryRestriction_downregulated
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly increased expression in daf-2(e1370) comparing to in control animals.	NOIseq(v2.34.0), fold change > = 1.5, Differentially expressed genes (DEGs) were defined as having a probability of differentialexpression > 95%.	WBPaper00064727:daf-2(e1370)_upregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated

10 Expression Patterns

• Primary Identifier: Expr1030722
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr2009313
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr6672
• Remark: Strain: BC14088
• Reporter Gene: [eat-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTGACGTCATTGGGAGAACTT] 3' and primer B 5' [ACGGTCACACGTTCGATCT] 3'.
• Pattern: Adult Expression: Nervous System; head neurons; tail neurons; Larval Expression: Nervous System; head neurons; tail neurons

• Primary Identifier: Expr3920
• Pattern: The ALP-1BCD/Enigma proteins are first detected during embryogenesis at the comma-stage in the cell-cell junctions of the embryonic hypodermis and in the hypodermal cell nuclei. At this stage, proteins begin to localize to circumferential fibers, similar to ALP-1A. At a later stage (fourfold), these circumferential bundles are more apparent, as is the late appearance of the ALP-1BCD/Enigma::GFPs in the developing body wall muscle. In a deeper optical section of the same embryo, it is evident that the ALP-1BCD/Enigma::GFP fusion proteins localize to cell-cell junctions in the developing pharynx. At this stage, the pharynx is still developing, and the arcade cells that are required to attach the anterior part of the pharynx to the mouth have not yet become epithelialized. Once the pharynx begins to differentiate, an enrichment of the ALP-1BCD/Enigma::GFPs was seen in the pharyngeal muscles and in specialized pharyngeal epithelial cells called marginal cells. This pharyngeal expression persists throughout development and is most prevalent in adults.
• Subcellular Localization: Expressed in the cell-cell junctions of the embryonic hypodermis and in the hypodermal cell nuclei.

• Primary Identifier: Expr8651
• Remark: Picture: Figure 2.
• Pattern: Immunostaining of wild-type worms using B74 or B78 revealed that endogenous ALP-1 proteins are highly expressed in the body wall muscle throughout postembryonic development. In addition, B78 (against ALP-1A, B, and D) also detects ALP-1 proteins at the apical and basal surfaces of the pharynx, another musculature structure in the worm, but at a very low level of expression.
• Subcellular Localization: To determine in which sub-region ALP-1 proteins are located, we colabeled body wall muscle with antibodies directly against ALP-1(B78) and vinculin. Double labeling with anti-ALP-1 and anti-vinculin antibodies revealed both proteins are localized at dense bodies, but ALP-1 is absent from muscle cellcell junctions (dense plaques) that contain vinculin. High magnification views of the dense bodies revealed that ALP-1 proteins colocalize with anti-actinin, but only have limited overlap with vinculin. These data indicate ALP-1 and -actinin colocalize within the dense body in a region that is spatially distinct from the basal, membrane proximal zone that accumulates vinculin. Within body wall muscle, anti-ALP-1 staining appeared in a periodic punctate array that was identified as dense bodies by colabeling with an anti-actinin antibody. It should be noted that in body wall muscle, using anti-ALP-1 antibodies authors did not observe any nuclear staining, such as that reported for the ALP-1::GFP translational reporter.

• Primary Identifier: Expr3919
• Pattern: The ALP-1A::GFP is expressed early in muscle development where it first appears during the comma-stage in the characteristic pair of bands that line the lateral surfaces of the embryo, demarcating the nascent body wall muscle cells. Throughout adulthood ALP-1A is most prevalent in the body wall muscle. In addition to the muscle expression, ALP-1A::GFP is expressed in the embryonic hypodermis.
• Subcellular Localization: This muscle-specific localization of ALP-1A::GFP first appears as the muscle cytoskeleton is being established and continues within developing musculature throughout embryogenesis where it is detected both cytoplasmically and in the body wall muscle nuclei. Just before embryonic elongation, ALP-1A::GFP is localized to periodic circumferential fibrils in the hypodermis that persist throughout embryogenesis. This localization pattern is coincident with morphogenetic actin bundles that are required for an actin-myosin-mediated contractile process that drives morphogenesis of the embryo. ALP-1A::GFP localization at these circumferential actin bundles persists throughout morphogenesis during which the fusion protein also localizes to cell junctions in the hypodermal seam cells. Later in development, ALP-1A::GFP expression was detected at the cell-cell junctions of the hypodermal seam cells during larval stages as well.

• Primary Identifier: Chronogram792
• Remark: Original chronogram file: chronogram.1832.xml
• Reporter Gene: [T11B7.4:gfp] transcriptional fusion.

• Primary Identifier: Expr1013432
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1156707
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2027549
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

33 GO Annotation

33 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00001132
• Start: 8852494
• End: 8862246
• Strand: 1

33 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 9753

1 Sequence Ontology Term

• Name: gene

3 Strains

• WBStrain00031648
• WBStrain00035455
• WBStrain00035457

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrIV_8851128..8852493
• Length (nt): 1366
• Chromosome Location: IV: 8851128-8852493
• Organism: Caenorhabditis elegans