WormMine: Gene WBGene00002637

• WormBase Gene ID: WBGene00002637
• Gene Name: let-418
• Sequence Name: F26F12.7
• Brief Description: The let-418 gene encodes a homolog of Mi-2/CHD3, a component of the nucleosome remodeling and histone deacetylase (NURD) complex; LET-418 is similar to DNA helicases, homologous to human AIRE (OMIM:607358, mutated in autoimmune polyendocrinopathy syndrome), and paralogous to CHD-3; with MEP-1, LET-418 is required to repress germline-specific genes in somatic cells, and also negatively regulates RAS-dependent postembryonic vulval development (via the synMuvB pathway); LET-418 and CHD-3 are redundantly required for specification of secondary cell fates in vulval development; LET-418 is expressed in all interphase nuclei throughout development; LET-418 is bound by MEP-1, and also interacts with HDA-1 and PIE-1; these interactions probably reflect repression of LET-418 by PIE-1 in the germline.
• Organism: Caenorhabditis elegans
• Automated Description: Enables RNA polymerase II-specific DNA-binding transcription factor binding activity. Contributes to RNA polymerase II transcription regulatory region sequence-specific DNA binding activity. Involved in embryonic digestive tract morphogenesis; negative regulation of transcription by RNA polymerase II; and negative regulation of vulval development. Part of RNA polymerase II transcription repressor complex. Expressed in several structures, including P3.p hermaphrodite; P4.p hermaphrodite; P8.p hermaphrodite; gonad; and somatic nervous system. Human ortholog(s) of this gene implicated in several diseases, including Sifrim-Hitz-Weiss syndrome; gastrointestinal system cancer (multiple); and lung adenocarcinoma. Is an ortholog of human CHD3 (chromodomain helicase DNA binding protein 3).
• Biotype: SO:0001217
• Genetic Position: V :-0.814163 ±0.000556
• Length (nt): 5999

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002637

Genomics

1 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:F26F12.7.1	F26F12.7.1	5655	V: 5826833-5832831

Other

1 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:F26F12.7	F26F12.7	5490	V: 5826861-5827190

19 RNAi Result

• WBRNAi00078289
• WBRNAi00083043
• WBRNAi00045655
• WBRNAi00075561
• WBRNAi00063052
• WBRNAi00022337
• WBRNAi00113477
• WBRNAi00063029
• WBRNAi00083941
• WBRNAi00000170
• WBRNAi00114896
• WBRNAi00114900
• WBRNAi00063053
• WBRNAi00081585
• WBRNAi00086817
• WBRNAi00000412
• WBRNAi00069989
• WBRNAi00075675
• WBRNAi00075676

88 Allele

• gk963301
• gk963591
• gk963553
• gk963041
• gk964259
• gk964351
• gk963850
• s1045
• WBVar01862421
• gk963626
• s1617
• WBVar00244415
• WBVar02023722
• n3719
• gk235993
• gk235994
• gk235992
• gk236001
• gk236002
• gk235999
• gk236000
• WBVar00209822
• gk235997
• WBVar00209821
• gk235998
• gk235995
• gk235996
• gk236009
• gk236010
• gk236007

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002637
• Start: 5826833
• End: 5832831
• Strand: 1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5832832..5833830
• Length (nt): 999
• Chromosome Location: V: 5832832-5833830
• Organism: Caenorhabditis elegans

171 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	oocyte proteins identified by two or more unique peptides during proteomics study.	In the pooled data set, 1453 C. elegans proteins were identified with a probability >= 0.9 according to ProteinProphet, of which 1165 proteins were identified by more than one unique peptide.	WBPaper00038289:oocyte_protein
	Transcripts of coding genes that showed significantly decreased expression in muscle.	DESeq2 (version 1.24.0). Transcripts with a false-discovery rate adjusted p-value less than 0.05 were considered significantly differentially expressed.	WBPaper00062325:muscle_depleted_coding-RNA
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	Transcripts that showed significantly higher expression in somatic gonad precursor cells (SGP) vs. head mesodermal cells (hmc).	DESeq2, fold change >= 2, FDR <= 0.01.	WBPaper00056826:SGP_biased
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
Bacteria diet: Sphingomonas aquatilis Yellow. Fed for 30 generations.	Transcripts that showed significantly decreased expression after fed by bacteria Sphingomonas aquatilis (Yellow) for 30 generations comparing to animals fed by E. coli OP50.	DESeq2 fold change > 2, p-value < 0.01.	WBPaper00061007:S.aquatilis_downregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Maternal class (M): genes that are called present in at least one of the three PC6 replicates.	A modified Welch F statistic was used for ANOVA. For each gene, regressed error estimates were substituted for observed error estimates. The substitution is justified by the lack of consistency among the most and least variable genes at each time point. Regressed error estimates were abundance-dependent pooled error estimates that represented a median error estimate from a window of genes of similar abundance to the gene of interest. A randomization test was used to compute the probability Pg of the observed F statistic for gene g under the null hypothesis that developmental time had no effect on expression. P-values were not corrected for multiple testing.	[cgc5767]:expression_class_M
	Transcripts that showed significantly increased expression in hrde-1(tm1200) animals, comparing to in N2, after growing at 25C for five generations (late generation).	CuffDiff2	WBPaper00051265:F4_hrde-1(tm1200)_upregulated
	Top 300 transcripts enriched in ABalppppppa, ABpraaapppa according to single cell RNAseq.	Top 300 enriched transcripts were determined by log2.ratio of the tpm in the cell type vs the tpm in the other cells * the log2 of the cell.type tpm.	WBPaper00061340:ASE_parent
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted
25C vs. 20C	Transcripts that showed significantly increased expression in 1-day post L4 adult hermaphrodite N2 grown at 25C, comparing to in N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:25C_vs_20C_upregulated
	Transcripts that showed significantly increased expression in 10-days post L4 adult hermaphrodite N2 grown at 20C, comparing to in 1-day post L4 adult hermaphrodite N2 animals grown at 20C.	CuffDiff, fold change > 2.	WBPaper00065096:Day10_vs_Day1_upregulated
	Transcripts that showed significantly decreased expression in tetraploid N2 comparing to diploid N2 animals at L4 larva stage.	DESeq2 R package (1.20.0), fold change > 2, and FDR < 0.05.	WBPaper00066110:tetraploid_vs_diploid_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L2-larva_expressed
	Genes that showed expression levels higher than the corresponding reference sample (L3/L4 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:PVD-OLL-neurons_L3-L4-larva_expressed
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Transcripts that showed significantly increased expression in pry-1(mu38) animals comparing to in N2 at L1 larva stage.	DESeq, FDR < 0.05	WBPaper00055626:pry-1(mu38)_upregulated
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Proteins interacting with HA-PPM-1.D.	N.A.	WBPaper00062498:PPM-1.D_interacting

10 Expression Patterns

• Primary Identifier: Expr1031359
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr5876
• Remark: Strain: BC14216
• Reporter Gene: [let-418::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTCCATGCGCAGATGA] 3' and primer B 5' [GTTGAGATTGTTGAATTCTCAGGA] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; distal tip cell; uterine muscle; vulval muscle; Nervous System; head neurons; neurons along body; tail neurons; Larval Expression: pharynx; intestine; Nervous System; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1200190
• Pattern: Data from the TransgeneOme project

• Primary Identifier: Expr9222
• Pattern: let-418p::Venus is strongly expressed in most if not all cells of the embryo. In young adults, let-418 transgene was primarily expressed in the head, the vulva, the tail, the ventral nerve cord and the distal tip cells. The let-418p::Venus construct was expressed in cells surrounding the pharynx, and strongly expressed the somatic gonad.

• Primary Identifier: Expr1045
• Remark: Expressed in most or all embryo cells. Reporter gene fusion type not specified.
• Pattern: Expressed in most if not all cells of the embryo. During larval development and in adults, expression of both reporters was observed in the nuclei of many cells, including the ventral nerve cord cells and the VPCs, the surrounding hypodermal cells and cells of the head and tail regions.
• Subcellular Localization: nuclei

• Primary Identifier: Expr2013058
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1802
• Remark: Original chronogram file: chronogram.713.xml
• Reporter Gene: [F26F12.7:gfp] transcriptional fusion.

• Primary Identifier: Expr2031290
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1149567
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1013785
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

25 GO Annotation

12 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002637
• Start: 5826833
• End: 5832831
• Strand: 1

25 Ontology Annotations

14 Regulates Expr Cluster

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly decreased expression in 100-cell stage embryo of let-418(RNAi) animals, comparing to in control RNAi (with gfp control vector) animals.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:let-418(RNAi)_downregulated_100-cell-embryo
	Transcripts that showed significantly increased expression in 24-cell stage embryo of let-418(RNAi) animals, comparing to in control RNAi (with gfp control vector) animals.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:let-418(RNAi)_upregulated_24-cell-embryo
	Transcripts that showed significantly increased expression in let-418(n3536);dcp-66(RNAi) comparing to control.	DESeq, fold change > 2.	WBPaper00062672:let-418(n3536)dcp-66(RNAi)_upregulated
	Transcripts that showed significantly increased expression in 24-cell stage embryo of chd-3(eh4)let-418(RNAi) animals, comparing to in N2 animals injected with gfp control RNAi vector.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:chd-3(eh4);let-418(RNAi)_upregulated_100-cell-embryo
	Transcripts that showed significantly increased expression in 100-cell stage embryo of let-418(RNAi) animals, comparing to in control RNAi (with gfp control vector) animals.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:let-418(RNAi)_upregulated_100-cell-embryo
	Transcripts that showed significantly increased expression in let-418(n3536) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:let-418(n3536)_upregulated
	Transcripts that showed significantly increased expression in 24-cell stage embryo of chd-3(eh4)let-418(RNAi) animals, comparing to in N2 animals injected with gfp control RNAi vector.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:chd-3(eh4);let-418(RNAi)_upregulated_24-cell-embryo
	Transcripts that showed significantly decreased expression in 24-cell stage embryo of chd-3(eh4)let-418(RNAi) animals, comparing to in N2 animals injected with gfp control RNAi vector.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:chd-3(eh4);let-418(RNAi)_downregulated_24-cell-embryo
	Transcripts that showed significantly increased expression in let-418(n3536) comparing to control.	DESeq, fold change > 2.	WBPaper00062672:let-418(n3536)_upregulated
	Transcripts that showed significantly decreased expression in 24-cell stage embryo of chd-3(eh4)let-418(RNAi) animals, comparing to in N2 animals injected with gfp control RNAi vector.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:chd-3(eh4);let-418(RNAi)_downregulated_100-cell-embryo
	Transcripts that showed significantly decreased expression in let-418(n3536);dcp-66(RNAi) comparing to control.	DESeq, fold change > 2.	WBPaper00062672:let-418(n3536)dcp-66(RNAi)_downregulated
	Transcripts that showed significantly decreased expression in let-418(n3536) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:let-418(n3536)_downregulated
	Transcripts that showed significantly decreased expression in let-418(n3536) comparing to control.	DESeq, fold change > 2.	WBPaper00062672:let-418(n3536)_downregulated
	Transcripts that showed significantly decreased expression in 24-cell stage embryo of let-418(RNAi) animals, comparing to in control RNAi (with gfp control vector) animals.	DESeq and EdgeR were used. A threshold of 1.5 log2 fold change and a p value <10 % were applied. let-418: wild-type; let-418(RNAi)-treated embryos; chd-3: chd-3(eh4);controlGFP(RNAi)-treated embryos; chd-3_let-418: chd-3(eh4); let-418(RNAi)-treated embryos. All fold changes are calculated versus wild-type;control(RNAi)-treated embryos. 1h and 3h correspond to the 24- and 100-cell stages, respectively.	WBPaper00050163:let-418(RNAi)_downregulated_24-cell-embryo

1 Sequence

• Length: 5999

1 Sequence Ontology Term

• Name: gene

5 Strains

• WBStrain00027456
• WBStrain00034737
• WBStrain00008003
• WBStrain00008004
• WBStrain00000738

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_5821849..5826832
• Length (nt): 4984
• Chromosome Location: V: 5821849-5826832
• Organism: Caenorhabditis elegans