WormMine: Gene WBGene00002999

• WormBase Gene ID: WBGene00002999
• Gene Name: lin-10
• Sequence Name: C09H6.2
• Brief Description: lin-10 encodes a PDZ and PTB domain-containing protein that is homologous to mammalian Munc interacting proteins (Mint1, OMIM:602414) and is required for polarized protein localization; LIN-10 is required for proper localization of the LET-23 EGF receptor to the basolateral membrane of the vulval precursor cells and for proper postsynaptic localization of GLR-1, an AMPA-type glutamate receptor in interneurons; LIN-10 is detected in the cytoplasm, membrane, and at particularly high levels in the Golgi.
• Organism: Caenorhabditis elegans
• Automated Description: Enables small GTPase binding activity. Involved in several processes, including neuron-neuron synaptic transmission; positive regulation of backward locomotion; and protein localization. Located in several cellular components, including Golgi trans cisterna; somatodendritic compartment; and trans-Golgi network transport vesicle. Expressed in several structures, including ganglia; somatic gonad precursor; somatic nervous system; vulva; and vulval precursor cell. Is an ortholog of human APBA1 (amyloid beta precursor protein binding family A member 1) and APBA2 (amyloid beta precursor protein binding family A member 2).
• Biotype: SO:0001217
• Genetic Position: I :2.55885 ±0.006545
• Length (nt): 9571

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00002999

Genomics

3 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:C09H6.2b.1	C09H6.2b.1	3257	I: 8109746-8119316
Transcript:C09H6.2a.1	C09H6.2a.1	3339	I: 8109746-8119314
Transcript:C09H6.2c.1	C09H6.2c.1	2796	I: 8110135-8118515

Other

3 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:C09H6.2b	C09H6.2b	2865	I: 8110135-8110240
CDS:C09H6.2a	C09H6.2a	2949	I: 8110135-8110240
CDS:C09H6.2c	C09H6.2c	2796	I: 8110135-8110240

9 RNAi Result

• WBRNAi00113309
• WBRNAi00001261
• WBRNAi00040271
• WBRNAi00002925
• WBRNAi00113080
• WBRNAi00070634
• WBRNAi00070633
• WBRNAi00091423
• WBRNAi00070635

110 Allele

• gk962858
• gk962706
• gk963902
• gk963849
• gk964316
• sy217
• WBVar01545952
• WBVar00154881
• WBVar00154882
• WBVar00154880
• WBVar00154883
• WBVar00154884
• WBVar01340757
• ttTi44149
• n1326
• ttTi44141
• WBVar01340746
• n1386
• n1387
• n1390
• n1402
• gk940025
• WBVar01835983
• n299
• gk940026
• n1509
• n1508
• n1511
• WBVar00267124
• h12330

1 Chromosome

• WormBase ID: I
• Organism: Caenorhabditis elegans
• Length (nt): 15072434

1 Chromosome Location

• Feature . Primary Identifier: WBGene00002999
• Start: 8109746
• End: 8119316
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

1 Downstream Intergenic Region

• WormBase ID: intergenic_region_chrI_8109229..8109745
• Length (nt): 517
• Chromosome Location: I: 8109229-8109745
• Organism: Caenorhabditis elegans

169 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Genes with expression altered >= 3-fold in dpy-10(e128) mutants.	Data across the wild type series was analyzed using the Significance analysis of Microarrays (SAM) algorithm (to calculate the False Discovery Rate (FDR)).	WBPaper00035873:dpy-10_regulated
	Coexpression clique No. 256, pek-1_22220-pek-1_33, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:pek-1_22220-pek-1_33
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:all-neurons_L1-larva_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	TGF- Dauer pathway adult transcriptional targets. Results obtained by comparing the microarray results of the dauer-constitutive mutants daf-7(e1372), daf-7(m62), and daf-1(m40) with dauer-defective mutants daf-3(mgDf90), daf-5(e1386), and daf-7(e1372);daf-3(mgDf90) double mutants at the permissive temperature, 20C, on the first day of adulthood.	SAM	WBPaper00031040:TGF-beta_adult_upregulated
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:AVE-neuron_L1-larva_expressed
	Neuronally enriched transcripts according to a comparison of neuronal nuclei IP samples to total nuclei using isolation of nuclei from tagged specific cell types (INTACT) technology.	DESEQ2, fold change > 2 and FDR < 0.01.	WBPaper00062103:neuron_enriched
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_6h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 10 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.1mix_downregulated_12h
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 6h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_6h
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
Bacteria infection: Bacillus thuringiensis	mRNAs that showed significantly decreased expression after pathogenic bacteria Bacillus thuringiensis infections comparing to non pathogenic BT (BT247(1 to 2 mix) vs BT407 12h), according to RNAseq.	Cuffdiff, ajusted p-value < 0.01.	WBPaper00046497:B.thuringiensis_0.5mix_downregulated_12h
	Transcripts that showed significantly increased expression in mrg-1(qa6200) comparing to in control animals in primordial germ cells (PGCs) at L1 larva stage.	DESeq2(v1.32.0), FDR < 0.05.	WBPaper00064315:mrg-1(qa6200)_upregulated_PGCs
	Transcripts that showed significantly decreased expression in N2 animals exposed to 0.1mM Paraquat from hatching to reaching adult stage.	DESeq2 version 1.22.2, p < 0.05	WBPaper00064716:paraquat_downregulated
	Transcripts that showed significantly changed expression in 6-day post-L4 adult hermaphrodite comparing to in 1-day post L4 adult hermaphrodite animals.	Sleuth	WBPaper00051558:aging_regulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Genes that showed expression levels higher than the corresponding reference sample (L2 all cell reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:A-class-motor-neurons_L2-larva_expressed

19 Expression Patterns

• Primary Identifier: Expr4974
• Remark: Picture: Fig 1 and Fig S1.
• Subcellular Localization: Diffuse staining pattern that labeled the entire HSNL axon.

• Primary Identifier: Expr5227
• Remark: Strain: BC10425
• Reporter Gene: [lin-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTGTTTTACCTGTCCTAGCAGT] 3' and primer B 5' [CTGCAACAGAATTGTTCATGGT] 3'.
• Pattern: Adult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr5228
• Remark: Also expressed in (comments from author) : Mosaic population. Strain: BC11925
• Reporter Gene: [lin-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTGTTTTACCTGTCCTAGCAGT] 3' and primer B 5' [CTGCAACAGAATTGTTCATGGT] 3'.
• Pattern: Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; seam cells; Nervous System; ventral nerve cord; unidentified cells; Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; ventral nerve cord; unidentified cells

• Primary Identifier: Expr5229
• Remark: Strain: BC12910
• Reporter Gene: [lin-10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTGTTTTACCTGTCCTAGCAGT] 3' and primer B 5' [CTGCAACAGAATTGTTCATGGT] 3'.
• Pattern: Adult Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; Larval Expression: intestine; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1031396
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr15958
• Pattern: mNG::LIN-7, LIN-2::mK2 and mNG::LIN-10 were found to bebroadly expressed in the worm. In L3 larvae, they were prominentlyexpressed in VPCs and neurons, whereas only LIN-7 and LIN-10 weredetectable in the somatic gonad primordium. In the VPCs,endogenous mNG::LIN-7 was strongly cytosolic, frequently found atpunctae, and occasionally localized to basolateral membranes.

• Primary Identifier: Expr15964
• Pattern: Endogenously tagged LIN-2, LIN-7, LIN-10 and LET-23 EGFRallow for the analysis of their localization and expression patterns in other tissues. We found that all four proteins are expressed inneurons and sensory tissue in the head, and along the ventral anddorsal nerve chords. The intestine is prone to a highdegree of autofluorescence and was excluded from the initialanalysis. Whereas LET-23 EGFR and LIN-7 overlapped minimallyin the head, LIN-2 and LIN-7 colocalized strongly in theneural ring, and the ventral and dorsal nerve chords. Ofnote, we observed that LIN-2 was more strongly expressed in theisthmus of the pharynx than LIN-7. In contrast, LIN-7 wasmore strongly expressed in the gonad and uterus than LIN-2. LIN-10 overlapped minimally with LIN-2 in the neural ring and nerve chords, and shared very little overlap with LET-23 EGFR in other neural tissues in the head of the worm. LET-23::mK2 was strongly expressed in the excretory duct cell in which it signals through the LET-60 Ras/MPK-1 ERK pathway to regulate excretory duct cell development (Abdus-Saboor et al., 2011; Yochem et al., 1997).

• Primary Identifier: Expr8630
• Remark: Picture: Figure 1L to 1M..
• Subcellular Localization: LIN-10::RFP was localized to perinuclear structures in the cell body and punctate structures along the ventral cord dendrites. To determine whether the punctate structures in the cell body correspond to Golgi-localized GLR-1 receptor, LIN-10::RFP, GLR-1::CFP, and mannosidase-YFP (MANS::YFP), a Golgi-resident protein, were coexpressed. They colocalized to punctate structures within the cell bodie.

• Primary Identifier: Expr8330
• Remark: Picture: Figure 7.
• Subcellular Localization: In the intestinal epithelia of C. elegans, RAB-10 associates with Golgi, and it is localized mainly to early endosomes. Like LIN-10, RFP::RAB-10 is present in neuronal cell bodies as well as throughout the ventral nerve cord neurites. However, unlike LIN-10::GFP, which localizes to relatively small, uniform puncta in neurites, RFP::RAB-10 localization is somewhat irregular with regard to the size and shape of clusters. Generally, RFP::RAB-10-containing clusters were less abundant and larger than LIN-10::GFP-containing clusters. Close association between RFP::RAB-10 and LIN-10::GFP was sometimes observed in neurites, as indicated by partial overlap between LIN-10::GFP and RFP::RAB-10 clusters. ~20% of LIN-10::GFP puncta were associated with a cluster of RFP::RAB-10, whereas ~40% of RFP::RAB-10 clusters were associated with one or more LIN-10::GFP puncta. While only ~5% of GLR-1::GFP clusters associated with RFP::RAB-10 clusters, and ~10% of RFP::RAB-10 clusters associated with GLR-1::GFP. These findings indicate that RAB-10 and LIN-10 are largely present at distinct compartments.

• Primary Identifier: Expr1282
• Pattern: In late L3 larvae, LIN-10 is present in descendants of the vulval precursor cells. Not detected LIN-10 staining in the vulval precursor cells in L2 or early L3 larvae, possibly because strong LIN-10 staining in adjacent ventral cord neurons obscures low-level LIN-10 expression in the vulval precursor cells at this stage. LIN-10 is expressed at high levels in neurons, including ring neurons, ventral cord neurons, dorsal cord neurons, lateral neurons, and neurons in the tail.
• Subcellular Localization: In VPC cells, LIN-10 staining is concentrated in punctate spots around the nucleus, and staining is diffuse in the cytoplasm and at the plasma membrane. LIN-10 appears in neuronal processes and cell bodies. In neural cell bodies, a small amount of LIN-10 appears diffusely throughout the cytoplasm, whereas the majority of LIN-10 is concentrated in discrete perinuclear structures, similar to perinuclear structures observed in vulval epithelial cells.

• Primary Identifier: Expr15678
• Pattern: Full-length LIN-10 localizes to cytosolic punctae in all VPCs.
• Subcellular Localization: LIN-10 colocalizes with Golgi markers in the VPCs.

• Primary Identifier: Expr2013156
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr1144340
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr1014238
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1385
• Pattern: lin-10 is expressed throughout development and embryonic expression is several fold higher than either larval or adult expression.

• Primary Identifier: Chronogram2046
• Remark: Original chronogram file: chronogram.955.xml
• Reporter Gene: [C09H6.2:gfp] transcriptional fusion.

• Primary Identifier: Chronogram1460
• Remark: Original chronogram file: chronogram.338.xml
• Reporter Gene: [C09H6.2:gfp] transcriptional fusion.

• Primary Identifier: Expr15961
• Subcellular Localization: LIN-10 and LIN-7 localize to the Golgi

• Primary Identifier: Expr2031388
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

43 GO Annotation

11 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00002999
• Start: 8109746
• End: 8119316
• Strand: -1

43 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 9571

1 Sequence Ontology Term

• Name: gene

20 Strains

• WBStrain00026966
• WBStrain00027021
• WBStrain00027048
• WBStrain00027049
• WBStrain00027047
• WBStrain00027051
• WBStrain00027080
• WBStrain00027109
• WBStrain00027131
• WBStrain00030927
• WBStrain00033502
• WBStrain00040215
• WBStrain00001334
• WBStrain00003964
• WBStrain00001947
• WBStrain00002396
• WBStrain00001335
• WBStrain00003962
• WBStrain00003963
• WBStrain00004333

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrI_8119317..8125800
• Length (nt): 6484
• Chromosome Location: I: 8119317-8125800
• Organism: Caenorhabditis elegans