WormMine: Gene WBGene00003916

• WormBase Gene ID: WBGene00003916
• Gene Name: par-1
• Sequence Name: H39E23.1
• Brief Description: par-1 encodes a serine-threonine kinase; maternally provided PAR-1 is essential for establishing early embryonic polarity; PAR-1 is present in the cytoplasm and in the cell cortex and asymmetrically localized to the posterior cortex of late one-cell stage embryos; PAR-1 is continuously asymmetrically localized to the P lineage (germline blastomeres) at each subsequent division, and evenly distributed to the Z2 and Z3 germline precursors before eventually fading at embryonic morphogenesis; PAR-1 kinase activity is required for the asymmetric distribution of MEX-5 in the early embryo via a phosphorylation/dephosphorylation cycle that regulates MEX-5's association with slow- or fast-diffusing RNA-containing complexes; PAR-1 can phosphorylate MEX-5 in vitro and in vivo.
• Organism: Caenorhabditis elegans
• Automated Description: Enables myosin II tail binding activity; protein serine/threonine kinase activity; and ubiquitin protein ligase binding activity. Involved in several processes, including cell fate commitment; embryonic pattern specification; and vulval development. Located in P granule and cell cortex. Expressed in germ line and vulva. Human ortholog(s) of this gene implicated in visual impairment and progressive phthisis bulbi. Is an ortholog of human MARK1 (microtubule affinity regulating kinase 1).
• Biotype: SO:0001217
• Genetic Position: V :6.17102 ±0.017922
• Length (nt): 33335

1 Organism

• Name: Caenorhabditis elegans
• Taxon Id: 6239

1 Synonyms

• Value: WBGene00003916

Genomics

18 Transcripts

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
Transcript:H39E23.1e.1	H39E23.1e.1	4673	V: 14112033-14126538
Transcript:H39E23.1a.1	H39E23.1a.1	4347	V: 14112034-14141119
Transcript:H39E23.1b.1	H39E23.1b.1	4070	V: 14112039-14132354
Transcript:H39E23.1j.1	H39E23.1j.1	4366	V: 14112039-14141119
Transcript:H39E23.1e.2	H39E23.1e.2	4594	V: 14112043-14126538
Transcript:H39E23.1m.1	H39E23.1m.1	5149	V: 14112046-14145367
Transcript:H39E23.1l.1	H39E23.1l.1	4091	V: 14112299-14128055
Transcript:H39E23.1i.1	H39E23.1i.1	690	V: 14112802-14114492
Transcript:H39E23.1k.1	H39E23.1k.1	1785	V: 14112802-14120829
Transcript:H39E23.1h.1	H39E23.1h.1	2118	V: 14112802-14121512
Transcript:H39E23.1g.1	H39E23.1g.1	3126	V: 14112802-14126206
Transcript:H39E23.1d.1	H39E23.1d.1	3651	V: 14112802-14126538
Transcript:H39E23.1c.1	H39E23.1c.1	3189	V: 14112802-14128838
Transcript:H39E23.1f.1	H39E23.1f.1	3312	V: 14112802-14131788
Transcript:H39E23.1e.3	H39E23.1e.3	3174	V: 14113764-14126538
Transcript:H39E23.1e.4	H39E23.1e.4	3441	V: 14114461-14126538
Transcript:H39E23.1e.5	H39E23.1e.5	3207	V: 14114461-14126538
Transcript:H39E23.1e.6	H39E23.1e.6	3880	V: 14114935-14126538

Other

13 CDSs

WormMine ID	Sequence Name	Length (nt)	Chromosome Location
CDS:H39E23.1b	H39E23.1b	3291	V: 14112802-14112915
CDS:H39E23.1i	H39E23.1i	690	V: 14112802-14112915
CDS:H39E23.1h	H39E23.1h	2118	V: 14112802-14112915
CDS:H39E23.1g	H39E23.1g	3126	V: 14112802-14112915
CDS:H39E23.1d	H39E23.1d	3651	V: 14112802-14112915
CDS:H39E23.1f	H39E23.1f	3312	V: 14112802-14112915
CDS:H39E23.1m	H39E23.1m	3390	V: 14117600-14117770
CDS:H39E23.1a	H39E23.1a	3579	V: 14112802-14112915
CDS:H39E23.1c	H39E23.1c	3189	V: 14112802-14112915
CDS:H39E23.1e	H39E23.1e	2901	V: 14117600-14117770
CDS:H39E23.1j	H39E23.1j	3603	V: 14112802-14112915
CDS:H39E23.1k	H39E23.1k	1785	V: 14112802-14112915
CDS:H39E23.1l	H39E23.1l	3321	V: 14112802-14112915

54 RNAi Result

• WBRNAi00038613
• WBRNAi00090670
• WBRNAi00087563
• WBRNAi00087565
• WBRNAi00087564
• WBRNAi00087567
• WBRNAi00000427
• WBRNAi00087566
• WBRNAi00111667
• WBRNAi00087573
• WBRNAi00079043
• WBRNAi00087577
• WBRNAi00087576
• WBRNAi00077257
• WBRNAi00068507
• WBRNAi00068506
• WBRNAi00077265
• WBRNAi00068509
• WBRNAi00068508
• WBRNAi00108647
• WBRNAi00068510
• WBRNAi00025822
• WBRNAi00063107
• WBRNAi00077279
• WBRNAi00077137
• WBRNAi00091360
• WBRNAi00008935
• WBRNAi00103693
• WBRNAi00083959
• WBRNAi00091367

484 Allele

• gk963271
• gk963706
• gk963301
• gk964458
• gk964459
• otn8967
• otn11458
• WBVar02062172
• WBVar02062171
• WBVar02062174
• WBVar02062173
• WBVar02062176
• WBVar02062175
• WBVar02062163
• WBVar02062162
• WBVar02062165
• WBVar02062164
• WBVar02062167
• WBVar02062166
• WBVar02062169
• WBVar02062168
• WBVar02062170
• WBVar01975383
• WBVar01975389
• WBVar01975388
• WBVar01975385
• WBVar01975384
• WBVar01975387
• WBVar01975386
• WBVar01975392

1 Chromosome

• WormBase ID: V
• Organism: Caenorhabditis elegans
• Length (nt): 20924180

1 Chromosome Location

• Feature . Primary Identifier: WBGene00003916
• Start: 14112033
• End: 14145367
• Strand: -1

4 Data Sets

• WormBaseAcedbConverter
• GO Annotation data set
• C. elegans genomic annotations (GFF3 Gene)
• Panther orthologue and paralogue predictions

0 Downstream Intergenic Region

184 Expression Clusters

Regulated By Treatment	Description	Algorithm	Primary Identifier
	Transcripts that showed significantly increased expression in L1 neural cells comparing to in adult neural cells.	DESeq2 (v1.18.1) fold change > 2, P-adj<0.05, using BenjaminiHochberg correction.	WBPaper00060811:L1_vs_adult_upregulated_neural
	Transcripts expressed in neuronal cells, by analyzingfluorescence-activated cell sorted (FACS) neurons.	DESeq. False discovry rate (FDR) < 0.1.	WBPaper00048988:neuron_expressed
adult vs dauer larva	Transcripts that showed differential expression in adult vs dauer lava in N2 animals at 20C.	N.A.	WBPaper00050488:adult_vs_dauer_regulated_N2_20C
	mRNAs that showed decreased expression in 1 cell mebryo comparing to in oocyte, according to RNAseq analysis.	Gaussian error propagation. As cutoff for the up-regulated genes authors used log2 fold change > 1 and P < 0.05 and as cutoff for the down-regulated genes authors used log2 fold change < -1 and P < 0.05.	WBPaper00045420:fertilization_downregulated_transcript
	Genes that showed expression levels higher than the corresponding reference sample (embryonic 24hr reference).	A Mann-Whitney U test with an empirical background model and FDR correction for multiple testing was used to detect expressed transcripts (Benjamini and Hochberg 1995). Genes and TARs with an FDR <= 0.05 were reported as expressed above background. Authors detected differentially expressed transcripts using a method based on linear models. Genes and TARs were called differentially expressed if the FDR was <= 0.05 and the fold change (FC) >= 2.0. To more strictly correct for potential false-positives resulting from multiple sample comparisons, authors divided individual FDR estimates by the number of samplesor sample comparisons, respectively. This resulted in an adjusted FDR of 1.3 * 0.0001 for expression above background and of 7.4 * 0.0001 for differential expression. Authors called genes selectively enriched in a given tissue if they met the following requirements: (1) enriched expression in a given tissue (FDR <= 0.05 and FC >= 2.0), (2) fold change versus reference among the upper 40% of the positive FC range observed for this gene across all tissues, and (3) fold-change entropy among the lower 40% of the distribution observed for all genes.	WBPaper00037950:bodywall-muscle_L1-larva_expressed
	Transcripts that showed significantly increased expression glp-1(e2141); TU3401 animals comparing to in TU3401 animals.	Fold change > 2, FDR < 0.01.	WBPaper00065993:glp-1(e2141)_upregulated
Bacteria infection: Enterococcus faecalis	Genes with increased expression after 24 hours of infection by E.faecalis Fold changes shown are pathogen vs OP50.	For RNA-seq and tiling arrays, log2 fold changes between gene expression values of infected versus uninfected nematodes were calculated. For log2 fold changes > 0.00001 the values > 81.25th percentile were defined as up-regulated and for log2 fold changes < -0.00001 the values < 18.75th percentile were defined as down-regulated.	WBPaper00038438:E.faecalis_24hr_upregulated_TilingArray
	Coexpression clique No. 203, sre-33-ZK1025.1_8337, on the genome-wide coexpression clique map for the nematode GPL200 platform.	All available microarray datasets for the GPL200 platform (Affymetrix C. elegans Genome Array) were obtained from the GEO repository. This included 2243 individual microarray experiments. These were normalized against each other with the software RMAexpress (Bolstad, 2014). Based on these normalized values, Pearsons correlation coefficients were obtained for each probe-probe pair of the 22,620 probes represented on this array type. The resulting list of correlation coefficients was then ranked to generate the ranked coexpression database with information on each probe represented on the GPL200 platform.	WBPaper00061527:sre-33-ZK1025.1_8337
	Transcripts that showed altered expression in cat-1(RNAi) animals comparing to control animals injected with empty vector.	p-value <= 0.05	WBPaper00066902:cat-1(RNAi)_regulated
	Proteins interacting with NHR-49-GFP according to co-IP and LC-MS.	N.A.	WBPaper00064071:NHR-49_interacting
	Transcripts expressed in the epithelial tissues surrounding the pharynx that includes the arcade and intestinal valve (AIV) cells, according to PAT-Seq analysis using Pbath-15-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:arcade_intestinal-valve_expressed
	Transcripts expressed in body muscle, according to PAT-Seq analysis using Pmyo-3-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:body-muscle_expressed
	Transcripts expressed in GABAergic neuron, according to PAT-Seq analysis using Punc-47-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:GABAergic-neuron_expressed
	Transcripts expressed in hypodermis, according to PAT-Seq analysis using Pdpy-7-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:hypodermis_expressed
	Transcripts expressed in intestine, according to PAT-Seq analysis using Pges-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:intestine_expressed
	Transcripts expressed in NMDA neuron, according to PAT-Seq analysis using Pnmr-1-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:NMDA-neuron_expressed
	Transcripts expressed in pharynx, according to PAT-Seq analysis using Pmyo-2-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:pharynx_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) and age at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_age_regulated_developing
	Transcripts expressed in seam cells, according to PAT-Seq analysis using Pgrd-10-GFP-3XFLAG mRNA tagging.	Cufflinks FPKM value >=1.	WBPaper00050990:seam_expressed
	Genes with expression level regulated by genotype (N2 vs CB4856) at old adults stage (214 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_aging
	Genes with expression level regulated by genotype (N2 vs CB4856) at L3 larva and Late reproduction stage (96 hours at 24 centigrade).	For model 2, authors used 100 permutations to estimate the FDR threshold. Per permutation, genotypes and ages were independently randomly distributed, keeping the among-gene structure intact. Then for each spot (23,232) on the array, model 2 was tested. The obtained P-values were used to estimate a threshold for each of the explanatory factors. Authors also used a genome-wide threshold of -log10 P-value = 2, which resembles an FDR of 0.072 and 0.060 for marker and the interaction age-marker for the developing worms and FDR of 0.050 and 0.065 for marker and age-marker for the aging worms. For the physiological age effect, authors used a log10 P-value = 8 in developing worms (0.012 FDR) and -log10 P-value = 6 (0.032 FDR).	WBPaper00040858:eQTL_regulated_developing
	Transcripts expressed in vulva.	FPKM >= 1.	WBPaper00064122:vulva_transcriptome
	Transcripts detected in germline isolated from day-1 adult hermaphrodite animals.	All three experiments have CPM >= 1.	WBPaper00067147:germline_expressed
	Transcripts that showed significantly increased expression in sin-3(tm1276) comparing to in N2.	DESeq2, fold change > 2, p-value < 0.01.	WBPaper00061203:sin-3(tm1276)_upregulated
starvation 12 hours	Transcripts that showed significantly increased expression in dissected intestines of N2 L1 larva that were starved for 12 hours, comparing to fed animals.	EdgeR, FDR < 0.05, fold change >= 2.	WBPaper00067259:starvation_upregulated_intestine
	Transcripts that showed significantly increased expression in aak-1(tm1944);aak-2(ok524) animals comparing to in N2.	DEseq 1.18.0, adjusted p-value < 0.05.	WBPaper00056471:aak-1(tm1944);aak-2(ok524)_upregulated
	Significantly upregulated genes from clk-1(qm30) microarrays using SAM algorithm with an FDR < 0.1 from adult-only chips.	SAM algorithm with an FDR < 0.1.	WBPaper00033065:clk-1(qm30)_upregulated
	Transcripts that showed significantly decreased expression in sin-3(tm1276) comparing to in N2 at early embryo when there were only 3 -5 eggs in the adult.	DESeq2, fold change > 2, adjusted p-value < 0.01	WBPaper00058598:sin-3(tm1276)_downregulated
	Transcripts depleted in purified oocyte P bodies comparing to in whole oocytes.	DESeq2, FDR < 0.05, fold change > 2.	WBPaper00065975:P-body_vs_oocyte_depleted

17 Expression Patterns

• Primary Identifier: Expr1031849
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr6294
• Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC11238
• Reporter Gene: [par-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTCTTTTCTTTCTGCTCTCTTGCT] 3' and primer B 5' [GACGCCGAGCTCATTGTT] 3'.
• Pattern: Adult Expression: body wall muscle; Nervous System; nerve ring; head neurons; tail neurons; Larval Expression: body wall muscle; Nervous System; nerve ring; head neurons; neurons along body; tail neurons

• Primary Identifier: Expr1033040
• Pattern: Tiling arrays expression graphs

• Primary Identifier: Expr16293
• Subcellular Localization: Using CRISPR-Cas9, we inserted a fluorescent tag at the endogenous locus encoding VAB-10B, PAR-1, SMA-1, EPS-8A, and H24G06.1, an uncharacterized protein. We found that, like PTRN-1, all five proteins localized to the apical membranes of the embryonic intestine.

• Primary Identifier: Expr578
• Remark: early embryo(author) = blastula + gastrulating embryo(curator).
• Pattern: Antibody staining is first detected at the bend of the reflexed hermaphrodite gonad. PAR-1 is seen in newly formed, but not mature oocytes nor newly fertilized zygotes. PAR-1 reappears in the late zygote, when both pronuclei are decondensed and the female pronucleus is just starting to migrate toward the posterior. In P0 through P3, it is localized in the posterior periphery so that it is distributed to the germ line blastomeres. When P4 divides, PAR-1 is distributed evenly and distributed to both Z2 and Z3. After P4 divides, PAR-1 gradually fades until it disappears at morphogenesis.
• Subcellular Localization: PAR-1 is membrane-associated. In dividing cells, it is restricted to the posterior until P4 divides, at which time it is located throughout the periphery. PAR-1 co-localizes with P granules.

• Primary Identifier: Expr14306
• Pattern: Consistent with previous reports in zygotes (Griffin et al., 2011; Guo and Kemphues, 1995), PAR-1::GFP was enriched on the posterior cortex, in a weak gradient in the posterior cytoplasm, on centrosomes and weakly on P granules. Asymmetric segregation was repeated in each P blastomere, with PAR-1::GFP enriched on the cortex destined for the next P cell daughter. Enrichment of PAR-1 in the germ lineage persisted through gastrulation. Cortical PAR-1 could be detected in most, and perhaps all, embryonic cells, but was present at higher levels in the primordial germ cells Z2 and Z3, daughters of the P4 blastomere.

• Primary Identifier: Expr1153277
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr9676
• Subcellular Localization: Before pronuclear formation, GFP::PAR-1 was uniformly distributed in the cytoplasm and weakly on the cortex (data not shown). At pronuclear formation, GFP::PAR-1 levels increased in the central cytoplasm and decreased in the peripheral cytoplasm. During pronuclear migration, GFP::PAR-1 levels remained low in the anterior-peripheral cytoplasm but increased in the posterior cytoplasm and on the posterior cortex. By nuclear envelope breakdown (NEBD), GFP::PAR-1 was enriched on the posterior cortex and formed a 3-fold anterior-low/posterior-high gradient in the cytoplasm, paralleling the gradient in MEX-5 diffusivity. Immunostaining of wild-type (WT) embryos with an anti-PAR-1 antibody confirmed the presence of a PAR-1 gradient in the cytoplasm of zygotes at NEBD. PAR-1 also localizes on centrosomes (bright dots) as reported previously ( Gnczy et al., 2001).

• Primary Identifier: Expr1020359
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr1020791
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012

• Primary Identifier: Expr2308
• Subcellular Localization: PAR-1 distribution was examined from the mid-L3 stage to young adulthood, using AJM-1 as a marker for the identity and position of vulval cells through vulval development. PAR-1 is localized near apical junctions prior to vulval development. This localization is common to other C. elegans epithelial cells. After fate specification and precursor proliferation, PAR-1 is not only found near apical junctions, but it is also associated with the cortex of the vulval cells. Through morphogenesis, PAR-1 gradually undergoes a redistribution from near apical junctions to the basolateral cortex. By young adulthood, PAR-1 is highly enriched in basolateral domains and little, if any, is still found associated with junctions. The PAR-1 distribution was identical using three different sources of antibodies to PAR-1 and, was sensitive to par-1(RNAi).

• Primary Identifier: Expr2018222
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Chronogram1765
• Remark: Original chronogram file: chronogram.680.xml
• Reporter Gene: [H39E23.1:gfp] transcriptional fusion.

• Primary Identifier: Expr1142820
• Pattern: Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/hashimshony2015

• Primary Identifier: Expr2032960
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2014726
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

• Primary Identifier: Expr2000007
• Pattern: Single cell embryonic expression. Only cell types with an expression fraction of greater 0.2 of the maximum expressed fraction are labeled (Full data can be downloaded from http://caltech.wormbase.org/pub/wormbase/datasets-published/packer2019/). The colors represent the broad cell class to which the cell type has been assigned. The size of the point is proportional to the log2 of the numbers of cells in the dataset of that cell type. Interactive visualizations are available as a web app (https://cello.shinyapps.io/celegans/) and can also be installed as an R package (https://github.com/qinzhu/VisCello.celegans).

51 GO Annotation

42 Homologues

1 Locations

• Feature . Primary Identifier: WBGene00003916
• Start: 14112033
• End: 14145367
• Strand: -1

51 Ontology Annotations

0 Regulates Expr Cluster

1 Sequence

• Length: 33335

1 Sequence Ontology Term

• Name: gene

10 Strains

• WBStrain00022387
• WBStrain00023555
• WBStrain00023576
• WBStrain00023586
• WBStrain00032319
• WBStrain00054777
• WBStrain00054776
• WBStrain00054775
• WBStrain00054774
• WBStrain00000253

1 Upstream Intergenic Region

• WormBase ID: intergenic_region_chrV_14145368..14146498
• Length (nt): 1131
• Chromosome Location: V: 14145368-14146498
• Organism: Caenorhabditis elegans